3. Shown here is the structure of a human gene.exonsintronsTranscription terminationsite (also poly A site)PromoterStart oftranscriptionm25%3'ATG50TACTAA12690130222850132ATT5'a. What is the length of the primary mRNA transcript (before splicing)?b. What is the length of the MRNA after splicingC. How many amino acids will this protein have?d. Where would you find a mutation that affects transcription of this gene?e. Where would you find a mutation that affects splicing?f.What effect would the mutation m2 have on pre-MRNA?g. What effect would mutation m2 have on the length of the mature mRNA?h. What effect would mutation M2 have on the protein produced?

According to our guideline we can answer only first 3 subparts of a question. So, upload the…

Answered: 3. Shown here is the structure of a…

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter16: Gene Expression

Section: Chapter Questions

Problem 20RQ: A scientist mutates elF-2 to eliminate its GTP hydrolysis capability. How would this mutated form of...

See similar textbooks

Similar questions

A binding .site for RNA polymerase is called a ___ . a. gene b. promoter c. codon d. protein
Three different bacteria species have the following consensus sequences upstream of a conserved gene. Species A Species B Species C -10 TAATAAT TTTAAT TATATT -35 TTGACA TTGGCC TTGAAA Table 15.2 Order the bacteria from most to least efficient initiation of gene transcription. A > B > C B > C > A C > B > A A > C > B
1. Transcription: a)State the role of RNA polymerase in gene transcription.b. Explain why the DNA is not used directly for protein translation (i.e., why is mRNA used instead?).c. Explain what occurs when a gene’s promoter region is open for RNA polymerase binding.d. Explain what occurs when a gene’s promoter regions is blocked from binding RNA polymerase.e. Explain how two cells, such as liver cells and skin cells, can become specialized in structure and function despite containing the same genome.
1.A portion of an mRNA attached to a ribosome reads: 5′ GACAUGAACAGC 3′ If a tRNA with a methionine amino acid attached is in the P site of the ribosome, a tRNA with which amino acid attached will enter the A site? Group of answer choices a. Glutamic Acid b. Lysine c. Threonine d. Asparagine 2. Active transcription does not occur in regions of chromatin loops that are located ________. Group of answer choices a. A large distance away from the MARS b. Within the euchromatin c. Near the MARS d. A large distance from the telomere 3. Given the DNA sequence 5′-AUG GCU AGA GUU GAA AAA-3′, which of these sequences represents a silent mutation? Group of answer choices a. 5′-AUG GUU AGA GUU GAA AAA-3′ b. 5′-AUG GCU UGA GUU GAA AAA-3′ c. 5′-AUG GCU AGA GUU GGA AAA-3′ d. 5′-AUG GCU CGA GUU GAA AAA-3′
1. Classify the type of mutation that have taken place: silent, missense and nonsense as a result of a single base substitution from UCG codon which codes for cysteine:a) AGC (ser): ________b) UGU (cys): ________c) GGC (gly): _______d) UGA (stop): _______e) UUC (phen): _______2. A single base addition and a single base deletion approximately 15 bases apart in the mRNA specifying the protein lysozyme from the bacterial virus T4 caused a change in the protein fromits wil-type composition….lys-ser-pro-ser-leu-asn-ala-ala-lys…..to the mutant form lys-val-his-his-leu-met-ala-alalys.a. Decipher the segment of mRNA for both the original protein and the double mutant.b. Which base was added? Which was deleted?3. Given is the 30 nucleotides in the human gene for hemoglobin (the oxygen-carrying protein in the red blood cells): 5’ TAC-CAC-GTG-GAC-TGA-GGA-CTC-CTC-TTC-AGA 3’a. What is the complementary strand?b. Deduce the mRNA in this coding region.c. What is the amino acid sequence based on this…
5’ATCGCGCTAGGCGCATGCTACCTAGGCTATCTGCCTAGCTATCGACTAATCTGATCGAGTCAG3’ 3’TAGCGCGATCCGCGTACGATGGATCCGATAGACGGATCGATAGCTGATTAGACTAGCTCAGTC5’ Write out the pre-mRNA for this geneWrite out the mRNA for this geneHow many amino acids does this protein have? Translate the protein Label your 5’ and 3’ UTR’s
Exons 1, 2 and 3 of a human gene are 156, 224 and 524 bp long respectively. The introns 1 and2 are 546 bp and 466 bp respectively.a. Draw this gene showing the promoter, exons, introns and transcription initiationsites.b. This gene is found to encode two mRNAs. One of these mRNAs is 224 bp in shorter thanthe other.i. What is the biological process giving rise to this phenomenon called?What are the sizes of the two mRNAs (in bp) produced from this gene?
4) Shown below is a schematic drawing of a gene, with the transcription unit divided into numbered regions. The arrows indicate transcription initiation sites, "D" indicates a splice donor site, "A" indicates a splice acceptor site, and "An" indicates a polyadenylation signal. Indicate all the possible mRNAs that could be produced from this gene (you don't need to draw new schematics - just list the regions that would be included in each mRNA by number)
91The mRNA Shine-Dalgarno sequence interacts with 26S rRNA anti-Shine-Dalgarno sequence. Yesorno 92Core polymerase (α2ββ’) use intact double-stranded DNA as a template. Yesorno 93Protein synthesis machinery reads the mRNA nucleotide sequence in groups of three bases or ______________. A.operatorsb.codonsc.open reading framesD.operons
The following diagram represents a transcription unit in a hypothetical DNA molecule. 5′ … TTGACA … TATAAT … 3′ 3′ … AACTGT … ATATTA … 5′ a. On the basis of the information given, is this DNA from a bacterium or from a eukaryotic organism? b. If this DNA molecule is transcribed, which strand will be the template strand and which will be the nontemplate strand? c. Where, approximately, will the transcription start site be?
1. If a mutation occurs in a coding region a. it will cause a change or changes in the normal (wild type) amino acid sequence. b. the protein may not form correctly and as a result does not perform the intended function. c. the type of mutation can be a missense mutation if there is some or limited protein function. d. the type of mutation can be a nonsense mutation if there is no protein function. e. all of the above 2. If a mutation occurs in a non-coding region: a. it will cause no change in the normal (wild type) amino acid sequence. b. the protein is unaffected and still functions correctly. c. the type of mutation is called a silent mutation. d. the protein may not form correctly and as a result does not perform the intended function. e. all of the above
Humans have ~20,000 genes which create > 100,000proteins used by our cells. What process enables thisevolutionary success story?A. Coupling of transcription and translation to producemature mRNAsB. Addition of the 5' cap and 3' poly-A tail to produce maturemRNAsC. Alternative expression of introns to produce maturemRNAsD. Alternative splicing of pre-mRNAs to produce maturemRNAs

SEE MORE QUESTIONS

Recommended textbooks for you

Biology 2e

Biology

ISBN:

9781947172517

Author:

Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:

OpenStax

Biology: The Dynamic Science (MindTap Course List)

Biology

ISBN:

9781305389892

Author:

Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:

Cengage Learning

Biology: The Unity and Diversity of Life (MindTap…

Biology

ISBN:

9781305073951

Author:

Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:

Cengage Learning

Biology 2e

Biology

ISBN:

9781947172517

Author:

Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:

OpenStax

Biology: The Dynamic Science (MindTap Course List)

Biology

ISBN:

9781305389892

Author:

Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:

Cengage Learning

Biology: The Unity and Diversity of Life (MindTap…

Biology

ISBN:

9781305073951

Author:

Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:

Cengage Learning

Biochemistry

ISBN:

9781305577206

Author:

Reginald H. Garrett, Charles M. Grisham

Publisher:

Cengage Learning

Biology: The Unity and Diversity of Life (MindTap…

Biology

ISBN:

9781337408332

Author:

Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:

Cengage Learning

SEE MORE TEXTBOOKS