Answered: 4. You have the following DNA strand.…

Name: 4. You have the following DNA strand. Synthesize a protein from this
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: 4. You have the following DNA strand. Synthesize a protein from this strand. (Recall that a leadersequence may precede the AUG initiation codon.)3' AGATTACTCGAGCCGGGTAATCGGC 5'a. MRNAb. Protein

Science

Biology

4. You have the following DNA strand. Synthesize a protein from this strand. (Recall that a leader sequence may precede the AUG initiation codon.) 3' AGATTACTCGAGCCGGGTAATCGGC 5' a. MRNA b. Protein

Biology: The Unity and Diversity of Life (MindTap Course List)

14th Edition

ISBN:9781305073951

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter9: From Dna To Protein

Section: Chapter Questions

Problem 2SQ: A binding .site for RNA polymerase is called a ___ . a. gene b. promoter c. codon d. protein

See similar textbooks

Similar questions

The AUC and AUA codons in mRNA both specify isoleucine. What feature of the genetic code explains this? complementarity nonsense codons universality degeneracy
A binding .site for RNA polymerase is called a ___ . a. gene b. promoter c. codon d. protein
3)What would be the third amino acid produced by the DNA strand: T A C C G A G T C A C G (Hint: use the mRNA strand you already coded)
5)Which type of nucleic acid would have the sequence "ACCGAUUG"? a)DNA b)mRNA c)Another type of nucleic acid d)More information is needed
4. It is known that RNA is a nucleic acid responsible for the synthesis of proteins. However, there is another nucleic acid alongside RNA: DNA. What role does the latter play in relation to RNA? a) RNA is synthesized in the cell in case too large a mutation damages the DNA. b) DNA has the reproductive genetic code of all cells and passes it on to RNA. c) DNA directs the synthesis of enzymes, while RNA synthesizes proteins. d) DNA synthesizes RNA according to a blueprint that includes the guidelines necessary for the structure of proteins.
1.The strand of DNA contains the sequence of bases: CGA CCG TAC. What is the sequence of the complementary strand? * a. GCT GGC ATG b. CCT CCG ATC c. GCU GGC AGC d. CCT GGC AGC 2.What is the arrangement of mRNA transcribing the DNA triplets: TAC TAG CCG CGA? * a. ATG ATC GGC GCT b. UAC UAG CCG CGA c. AUG AUC GGC GCU d. AUG ATG GGC GCA 3. A DNA base sequence is 90 bases long. How many codons can these sequence order? * a. 270 b. 180 c. 90 d. 30 4. Which of the following statements regarding translation is true? * a. there are 3 start codons and 1 stop codon b. there is one start and 3 stop codons c. there are 3 start and stop codons d. there is one stop codon and one start codon
7. A segment of a DNA strand consists of ...GCTTAGACCTGA.... (a) Identify the expected nucleotide order in the complementary mRNA (b) Identify the sequence of amino acids coded for by this segment of DNA. (c) Describe the bond that forms during translation to link amino acids together. Identify the functional groups that react and the atoms involved.
1. Considering the following nucleotide sequence in an mRNA molecule: 5’ AUG UUA CGU AAU GCU GUC GAA UCU AUU UGC UUU ACA UAA 3' a) Write the sequence of the DNA template (antisense) strand from which the mRNA was synthesized. b) Write the sequence of the DNA coding (sense or informational) strand complementary to the template strand. c) Write the sequence of tRNA anticodon that corresponds to the given mRNA molecule. d) Write the amino acid sequence of the peptide synthesized from the given mRNA nucleotide sequence. e) Draw the structure of the pertide fragment made up of the first five (5) amino acids in the given polypeptide.
Consider a template strand of DNA with the following sequence: 3 '–CAA TGT ATT TTT GCT–5 '. (a) What is the informational strand of DNA that corresponds to this template? (b) What mRNA is prepared from this template? (c) What polypeptide is prepared from the mRNA?
1. What amino acids are specified by the following base triads on DNA?a. TCAb. CCtc. GGC d. GATe. TTA 2. What amino acids are specified by each of the following codons on an mRNA molecule? a. CAU b. UCC c. AGA d. GCG e. AAA
The template strand of DNA is 3’AGGATGCACGTAC5’ The sequence of the mRNA that is made from this DNA is: A) 5’UCCUACGUGCAUG3’ B) 5'AGGATGCACGTAC 3’ C) 3’UCCUACGUGCAUG5’ D) 3’AGGAUGCACGUAC5’ E) 5’AGGAUGCACGUAC3’
Below is a DNA template strand for RNA transcription where the * and “ mark the beginning and end of 2 introns. Show what the final mRNA would look like. 5’ ATTTGCG*AATGAGAGTCC*GCATTACGATG“CAATGCAGTG”TTTAAGCGCGCATTAA 3’