5) PCR primers have a melting temperature (Tm) at which they become dissociated from the template DNA. This Tm is calculated by their length and their base composition. Suppose you have two PCR primers that are the exactly same length (each 20 nucleotides long). Primer A has a Tm of 60°C and Primer B has a Tm of 63°C. Based on what you know about DNA structure, hypothesize why there is a difference in Tm between the two primers?

5) PCR primers have a melting temperature (Tm) at which they become dissociated from the template DNA. This Tm is calculated by their length and their base composition. Suppose you have two PCR primers that are the exactly same length (each 20 nucleotides long). Primer A has a Tm of 60°C and Primer B has a Tm of 63°C. Based on what you know about DNA structure, hypothesize why there is a difference in Tm between the two primers?

Name: 5) PCR primers have a melting temperature (Tm) at which they become d
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: 5) PCR primers have a melting temperature (Tm) at which they become dissociated from the template DNA. ThisTm is calculated by their length and their base composition. Suppose you have two PCR primers that are theexactly same length (each 20 nucleot

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 1TYK

See similar textbooks

Similar questions

You have two PCR primers: Forward- 5' TGAGCTAGGC 3' and Reverse- 5' GGTTCAGTCAG 3'. Show the binding sites of the primers to their Double strand DNA template. As the primer sizes are 10 and 11 bp, just write a 30 bp double stranded DNA (making sure the 5' and 3' ends of the double strand DNA in all 4 ends) and show where in the 30 bp double stranded DNA, these two primers would bind in correct orientation.
In experiments using polymerase chain reactions (PCR), it is often more difficult to amplifythrough regions of DNA that are high in GC content versus those regions that are either lower inGC content or are AT-rich. Based on your knowledge of DNA structure, explain why.
The typical cycle of a PCR reaction includes a period of time at 95 degrees, 55 degrees, and 72 degrees. Match the temperature to the event that happens at that temperature. - 95 degrees 55 degrees 72 degrees A. the DNA polymerase enzymes build new DNA at this temperature, starting from the 3' hydroxyl end of the annealed primers B. the pre-synthesized primers find their complementary sites on the template and attach via hydrogen bonds at this temperature C. the complementary strands of the DNA become separated at this temperature
Assume the sequence below is one half of a double stranded DNA template used in a PCR reaction. The highlighted sequences indicate the region bound by primers, either on this strand or on the other complementary strand. 5' ACGTGCGACACGTATATATGTCGCGTGAGTGTAGCGTATCGCTAGAGACGCATACCTATG 3' If the sequence of the forward primer is 5' GCGACACG 3', which of the following sequences would represent the reverse primer? a. 5’ – CAGAGATCGC – 3’ b. None of these sequences would represent the reverse primer c. 5’ – GTCTCTAGCG – 3’ d. 5’ – GCGATCTCTG – 3’ e. 5’ – CGCTAGAGAC – 3’
For the following short sequence of double stranded DNA, design primers (just ~ 3-4 bases) and show 2 copy cycles of PCR (refer to figure 13.25) for the amplification of this sequence of DNA (so that you have 4 double stranded DNA). 5’- GGTATTGGCTACTTACTGGCATCG- 3’ 3’- CCATAACCGATGAATGACCGTAGC- 5’
1. What happens in the denaturing step of PCR? A. What happens during the annealing step of PCR? B. What happens during the extension step of PCR? C. What temperatures is associated with each PCR step? D. Why is it necessary to have a primer on each side of the DNA segment to be amplified? (Hint: draw it out to see what happens with only one primer). E. How did the Taq DNA polymerase acquire its name? F. Why are there nucleotides (A, T, G, C) in the master mix? What are the other components of the master mix and what are their functions?
How would you approach this problem? You plan to sequence the following DNA by Sanger sequencing. Your reaction includes your sequencing primer (5' is on the left) and template DNA (5' end is on the left), dNTPs, buffer, DNA polymerase and the following fluorescent ddNTPs: red ddGTP, green ddATP and blue ddTTP. Sequencing Primer: CCGCCGGGCCCCAT Template to be Sequenced: GAGCGGCGGGCTGAGTAGCTCGCCGCGGGGATGGGGCCCGGCGGATT
You Purified plasmid DNA (a 6.0 kb vector) and got the following results... DNA conc: 200 ng/µL A260/280: 1.97 A260/230: 2.15 How would you to set up a ligation reaction with 50 ng of digested DNA and a 1254 base pair PCR insert present at a concentration of 23 ng/µL. How should you pipet the necessary nucleotide components (vector and PCR insert) to obtain a 1:5 vector to insert molar ratio? Keep in mind limitations of pipets when giving your answer.(e.g. Pipetes won't go below 0.5µL)
Considering the Polymerase Chain Reaction (PCR), we can state that: a) It is a technique that promotes linear amplification of the number of DNA molecules in a sample. b) Depends on an initial template which can be a DNA or RNA molecule c) The reaction must contain, in addition to the template sequence, nitrogenous bases, sense and antisense primers and DNA polymerase enzyme. d)The primer sense rings on the template strand 3’>5’, extending from the 3’ end e)
The diagram illustrating the polymerase chain reaction (PCR) technique is provided below. How does the number of copies of the DNA region being amplified change at the end of each cycle of the polymerase chain reaction? Group of answer choices a. The number of copies triples (or triplicates). b. The number of copies does not change. c. The number of copies quadruples (or quadruplicates). d. The number of copies doubles (or duplicates). e. The number of copies halves.
By mistake, you add two primers to your DNA sequencing reaction. The primers anneal on the same strand but 20 bases apart. Which of the following best describes how your sequence will look?A. The sequence will be readable for the first 20 bases only.B. The detector will detect two nucleotides at about 75% of the positions.C. The sequence will be readable for the last 20 bases only.D. The detector will detect one nucleotide at about 75% of the positions.E. The detector will detect no nucleotides at any of the positions. Explain why it is B.
For the following short sequence of double stranded DNA and the given primers, there will be one major duplex DNA product after many cycles (imagine 10 cycles) of PCR. Provide the sequence of this one major duplex product and label the 5’ and 3’ ends of each strand. Sequence to be amplified: 5’- GGTATTGGCTACTTACTGGCATCG- 3’ 3’- CCATAACCGATGAATGACCGTAGC- 5’ Primers: 5’-TGGC-3’ and 5’-TGCC-3’