7. The diagram below represents the full mRNA transcribed from the trp operon under conditions of lowtryptophan. Grey blocks indicate protein coding sequences. Annotate the diagram by indicating theexpected positions of the elements listed below, add more detail to the diagram if required to allowyou to accurately annotate it. Use only the letters A - H (e.g. "A" for structural genes). Where a labelrefers to a region, you must use a bracket to indicate the extent of the region in conjunction withthe specific letter.A. Structural genesB. Leader peptideC. Two adjacent trp codonsD. 5' UTR and 3' UTRE. Ribosome binding siteF. Site of potential transcription termination from attenuationG. Regions with sequence complementarityH. Stretch of Us5'EDC BA3'

1. **Structural genes (A)**: These genes are part of the trp operon and are responsible for encoding…

Answered: 7. The diagram below represents the…

Human Anatomy & Physiology (11th Edition)

11th Edition

ISBN:9780134580999

Author:Elaine N. Marieb, Katja N. Hoehn

Publisher:Elaine N. Marieb, Katja N. Hoehn

Chapter1: The Human Body: An Orientation

Section: Chapter Questions

Problem 1RQ: The correct sequence of levels forming the structural hierarchy is A. (a) organ, organ system,...

See similar textbooks

Similar questions

6. Indicate whether each of the following events occurs when tryptophan is high or when tryptophan is low by placing a check in each of the appropriate blanks. Share your reasoning. Tryptophan Tryp high Event Ribosome does not stall at Trp codons Region 2 of the leader pairs with region 3 Ribosome covers part of region 2 of leader Transcription is terminated before structural genes are transcribed
1. A DNA base sequence transcribed into messenger RNA in the following sequence: TTATCTTCGGGAGAGAAAACA. a. If you read from left to right, what amino acids are coded by this sequence? (Note: The initiation sequence is disregarded in this example.) b. If proflavine treatment caused the deletion of the first adenine nucleotide on the left, describe the changes that would occur in the first six amino acids coded by this sequence?
20. in differential translation, a different transcript may be recovered depending on which TATA box is used true or false
3. You have assembled a very short contig below, but you don't know if this is the sense or antisense strand. Determine the mRNA sequence in either case, and then provide a 6 frame translation. 5' - ATACGGGCAATTACAGTCTAGA – 3' If this is the sense (+) strand, what is the corresponding mRNA sequence? If this is the antisense (-) strand, what is the corresponding mRNA sequence? For BOTH mRNA sequences you just determined, provide a 3 frame translation for each (i.e. a 6 frame translation, in total)
5. What is the correct reading frame for the following mRNA? MRNA 5' GGCACUUAUGCGAUGCCUUGAGUGACCAU 3'
17) Which mRNA modification is likely absent if the mRNA is degrading prematurely from the 5’ end of the mRNA? A) addition of the 3’ polyadenylated tail B( splicing together if exons C removal of introns D RNA editing E addition of the 7- methlgguanosine cap to the 5’ end
1 An Amino Acid Sequence Leu - Tyr - Gly-Gly - Val Which of the following changes to the mRNA that produces the amino acid sequence shown above would be characterized as a missense mutation? Select one: O A. CUC UAG GGU GGC GUA OB. CUC UAC GGG GGC GUA OC. CUC UAC GGU GGC GCU O D. CUC UAU GGU GGC GUA
6. A portion of a gene is shown below. 5'-ATGATTCGCCTCGGGGCTCCCCAGTCGCTGGTGCTGCTGACGCTGCTCGTCG-3' 3'-TACTAAGCGGAGCCCCGAGGGGTCAGCGACCACGACGACTGCGACGAGCAGC-5' The sequence of the mRNA transcribed from this gene has the following sequence: 5'-AUGAUUCGCCUCGGGGCUCCCCAGUCGCUGGUGCUGCUGACGCUGCUCGUCG-3′ a. Identify the coding and noncoding strands of the DNA. b. Explain why only the coding strands of DNA are commonly published in databanks.
1. Draw a diagram of the lac operon. PO I+P+O+Z+Y+ I+P+OcZ+Y- I-P+O+Z+Y+ Lab section (circle): lacz gene lac Y gene lacA gene I+P+O+ZY/IPO+Z+Y- 2. The promoter (P) is the start site of transcription through the binding of RNA polymerase before actual mRNA production. Mutated promoters (P) cannot bind RNA polymerase, so no mRNA is made. In the table below, make predictions about the expression of ß-galactosidase and permease for different partial diploid (F') genotypes. Do this for E. coli growth on two different types of media - one without lactose, and one with. Use a to mark where there is no enzyme produced, and a + to mark where the enzyme is made. The first genotype has all wild-type alleles, and has been filled in as an example. Genotype IPOCZ+Y/I-P+O+Z-Y+ ISP+O+Z+Y/I+P+O+Z*Y* CR 1:00 Lactose absent B-galactosidase Permease R 3:-00 + R 6:30 Lactose present B-galactosidase F 10:00 Permease
1. For the genotypes and conditions (lactose present or absent) shown in the following table predict whether functional enzymes, nonfunctional enzymes, or no enzymes are made. 2. Even though the LacZ,Y and A structural genes are transcribed as a single polycistronic mRNA, each gene contains the initiation and termination signals essential for translation. Predict what will happen when a cell growing in the presence of lactose contains a deletion of one nucleotide early in the Z gene and early in the A gene.
8. The following diagram illustrates a step in the process of translation. fMet Pro mRNA UAC GGG AUGCCCACG UAG a) Identify the following elements on the diagram. Aminoacyl site (A) Peptidyl site (P) Exit site (E) Amino end of the newly synthesized polypeptide chain Carboxyl end of the newly synthesized polypeptide chain Approximate location of the next peptide bond that will be formed
The diagram below shows an imaginary eukaryotic structural gene containing two exons. The exon nucleotides are numbered beginning at the transcription start site and a portion of the intron is not shown to save space: Help Center? transcription start site promoter U STACAGTATAAATGAATTAATTGACGTATGTCAATCGGTAAGT...TCAGGTACT U UUU} Phe UUG} Leu exon 1 3 ATGTCATATTTACTTAATTAACTGCATACAGTTAGCCATTCA...AGTCCATGAATGACTTATGTGCGGTTATTTACTGAT... Second letter C Predict the amino acid sequence of the polypeptide encoded by this structural gene. The genetic code is provided below.

SEE MORE QUESTIONS

Recommended textbooks for you

Human Anatomy & Physiology (11th Edition)

Biology

ISBN:

9780134580999

Author:

Elaine N. Marieb, Katja N. Hoehn

Publisher:

PEARSON

Biology 2e

Biology

ISBN:

9781947172517

Author:

Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:

OpenStax

Anatomy & Physiology

Biology

ISBN:

9781259398629

Author:

McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter

Publisher:

Mcgraw Hill Education,

Human Anatomy & Physiology (11th Edition)

Biology

ISBN:

9780134580999

Author:

Elaine N. Marieb, Katja N. Hoehn

Publisher:

PEARSON

Biology 2e

Biology

ISBN:

9781947172517

Author:

Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:

OpenStax

Anatomy & Physiology

Biology

ISBN:

9781259398629

Author:

McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter

Publisher:

Mcgraw Hill Education,

Molecular Biology of the Cell (Sixth Edition)

Biology

ISBN:

9780815344322

Author:

Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter

Publisher:

W. W. Norton & Company

Laboratory Manual For Human Anatomy & Physiology

Biology

ISBN:

9781260159363

Author:

Martin, Terry R., Prentice-craver, Cynthia

Publisher:

McGraw-Hill Publishing Co.

Inquiry Into Life (16th Edition)

Biology

ISBN:

9781260231700

Author:

Sylvia S. Mader, Michael Windelspecht

Publisher:

McGraw Hill Education

SEE MORE TEXTBOOKS