9. You have two tubes, each containing a different DNA fragment. The fragments are the same different, known sequences. The labels have worn off the tubes, so you don't know which tu Hnw ran You use restristion enzymes to determine which tube of DNA contains which fragme

9. You have two tubes, each containing a different DNA fragment. The fragments are the same different, known sequences. The labels have worn off the tubes, so you don't know which tu Hnw ran You use restristion enzymes to determine which tube of DNA contains which fragme

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 1TYK

See similar textbooks

Related questions

Q: 5) PCR primers have a melting temperature (Tm) at which they become dissociated from the template…

A: A primer is a short strand of nucleotide molecules that serves as an initial point for the synthesis…

Q: 1. An image of a DNA profile is shown below. The size marker fragments are not shown, but the size…

A: STR stands for Short Tandem Repeat . This analysis is a common molecular biology method. It is used…

Q: 2. Shown below is a long template strand of DNA where lagging strand DNA synthesis is occurring. The…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: purpose(s) of DNA extraction

A: The purpose of DNA extraction are: To study the genetic cause of the disease. For the development…

Q: . The following represents a DNA strand in the process of replication. The bottom sequence is that…

A: According to guidelines we have to answer the first question only. so please kindly post the…

Q: Sticky ends are single stranded DNA overhangs that: O stabilize DNA from nucleases O form primers…

A: DNA ligases join DNA molecules together by synthesizing phosphodiester bonds between nucleotides…

Q: Draw a stretch of DNA that would code for the amino acid "lysine". Be sure you draw all the…

A: The given structure is shown below.

Q: Given the DNA strand with sequence 5' AUGGAGGAUGGCCAGUCAAUUUGA 3' match the various mutations to the…

A: Codon is a sequence of three nucleotides that corresponds to a specific amino acid. Codons encode…

Q: 1. The DNA strand which is mostly like to form DNA Z DNA A = 5' GGG GCT AGC CCC 3' DNA B = 3' ATA…

A: We are authorized to answer the first three questions at a time since you have not mentioned which…

Q: 7. Once the DNA has been extracted from the nucleus of the cell, t is exposed to that act like a…

A: Nucleic acid is a biological macromolecule present inside the nucleus of the cell . Nucleic acid…

Q: 1. Draw a replication fork in the space below. Be sure to label the 5' and 3' ends of the DNA on…

A: In the process of DNA replication, the DNA makes multiple copies of itself.

Q: 1 Restriction enzymes cut DNA molecules atspecific locations to produce restriction fragments…

A: Restriction enzymes refer to the enzymes that generate fragments of DNA (deoxyribonucleic acid)…

Q: 1. Calculate the size of the resulting fragments as they will occur after digestion and write the…

A: Hello. Since your question has multiple parts, we will solve the first question for you. If you want…

Q: You have 15 tubes, each containing 5 ul of DNA (each tube has a different DNA to cut). You want to…

A: A reaction mixture is a combination of 2 or more reactants in definite proportions to carry out a…

Q: 9. Why does the lagging strand need Ligase? * O Polymerase runs 5' to 3'. This creates fragments and…

A: Replication is the process which is responsible for producing daughter DNA molecules from the…

Q: Give the COMPLIMENTARY DNA strand. 3'TAC TAC TTT AMA TCA CTC TCC GCT GGT GTG AGT TGC CCT ACT 5

A: Deoxyribonucleic acid or DNA is a biomolecule composed of two polynucleotide chains that coil around…

Q: DNA polymerase is the enzyme that synthesizes new DNA during DNA replication. DNA polymerase…

A: DNA polymerase is an enzyme that is responsible for DNA synthesis.

Q: TRUE OR FALSE: a) Okazaki fragments are short DNA pieces that explain how the DNA polymerase can…

A: DNA replication process is semi conservative. The semi conservative replication of DNA refers to the…

Q: E14. A sample of DNA was subjected to automated DNA sequencing and the output is shown here. WWww…

A: DNA Sequencing is the technique to determine the order of the nucleotides within the DNA…

Q: 5. Below is an image of DNA sequenced using the Sanger sequencing method, where different…

A: Gel electrophoresis is a molecular technique that aims to separate the DNA, RNA, and protein…

Q: 6.c. Mutated DNA Template Strand #3: 3’-T A C T G A C T G A C T A T C-5’ Complementary DNA sequence:…

A: Mutation is the change in the nucleotide sequence in DNA or RNA that causes a change in the…

Q: 6.d. Mutated DNA Template Strand #4: 3’-T A C G A C T G A C T A T C-5’ Complementary DNA sequence:…

A: Replication is the process of formation of identical copies of DNA. It occurs in nucleus.…

Q: then he has to chop it up Dr. A. Zion wants to study the flight gene of birds. In order to study the…

A: Information Given: Zion wants to analyse DNA sample of a bird from it's flight gene 1st blank: First…

Q: A portion of one strand of DNA has the sequence 5′ AATGGCTTA 3′. If this strand is used as a…

A: DNA polymerase moves along the template strand in a 3'–5' direction, and the daughter strand is…

Q: Whatis the purpose of the dideoxynucleotides in DNA sequencing? OCH2 base - OCH2 base H. H. H. H. H.…

A: ddNTP(dideoxynucleotide triphosphate) used in sanger dna sequencing .which terminate the…

Q: Which of the following double stranded DNA molecules would require the most amount of energy to…

A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…

Q: GAATTC GAATTO CITAAG CITAAG double-stranded DNA DAATT DAATTO CTAA G CTAA GI AAT TO CTTAA GAATTO…

A: The cloning is routinely used in biotechnology laboratories and it is the process by which a foreign…

Q: A Original DNA CCT ATA TCT CTC TAT ATC TCT CAT ACT GTG TOT CTO TAT Complementary DNA B. Make lenteal…

A: Since you have asked multiple questions , we will solve the first question for you. If you want any…

Q: What is happening at letter "C"? O RNA Primase is laying down some RNA Primer on the lagging strand…

A: DNA replication is a process by which one parent DNA replicates to form two identical daughter DNA.…

Q: he purpose of using a washing soap in DNA extraction experiment is to D a. Cut the proteins away…

A: DNA stands for deoxyribonucleic acid. It is present in the nucleus of the cell It stores genetic…

Q: 1. The polymerase chain reaction (PCR) is used by scientists to amplify DNA, particularly when the…

A: We are answering 1st question only. For the rest of the questions please repost. The polymerase…

Q: Sticky ends are 1. DNA fragment with single - stranded ends 2. produced by the action of DNA…

A: DNA is the nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid in which…

Q: You have this sequence of DNA from leading strand: GGCATGCGA From this you know: * O G is the 5'end…

A: DNA acts as genetic material in all living organisms. During replication of DNA, at each replication…

Q: 4) Repetitive DNA comprises about _________ of chromosomal DNA A) 5% B) 40% C) 60% D) 95%

A: DNA is the genetic material in most living organisms. It carries information for synthesis of all…

Q: 1. What is the basis of separation of different DNA fragments by gel electro- phoresis? a. The…

A: Since you have asked multiple questions, we will solve the first question for you. If you want any…

Q: 4. A linear fragment of DNA is exposed to a digest containing the individual restriction enzymes…

A: For doing restriction mapping we need to arrange each fragments at it's proper position. The process…

Q: The direct manipulation of genes is called O genetic engineering O DNA sequencing nucleic acid…

A: Gene can be defined as a unit of heredity.It is a segment of DNA(nucleotide sequence)that may…

Q: 22. Which statement is correct about restriction enzyme? O They cut methylatedsite O They cut…

A: A restriction enzyme detects a certain short nuclear sequence and specifically breaks DNA at that…

Q: Which of the following is/are not required for DNAreplication to occur?a. DNA polymerase d.…

A: DNA (short for deoxyribonucleic acid) is a double helical structure (with two DNA strands). A…

Q: The following nucleotide sequence is found in a short stretch of DNA: 5′–AG–3′ 3′–TC–5′ a. Give all…

A: the genome is never a static entity, it constantly undergoes changes in its sequence either due to…

Q: What is the name of the process by which bacteria pick up a different organism’s genetic material?

A: 4. A bacterium takes up a fragment of DNA circulating in its surroundings during transformation. A…

Q: Which of the following DNA has a high G-C content? (Tm refers to the melting temperature of the DNA.…

A: In double stranded DNA the adenine binds with thymine and guanine binds with cytosine. This four…

Q: 2.Fill in the blank with the best answer. If band 3 (6 kB) in lane 5 contains 280 ng of DNA, then…

A: Fill in the blank the question. Average weight of one DNA base pairs= 650 Dalton. 1 Dalton =…

Q: uit L Tepresents part of a DNA molecule. 5' T ATGCTT C CA TACG A AGG TCA 3' 3' G T Figure 2 (c)…

A: The process of replicating a double-stranded DNA molecule into two identical DNA molecules is known…

Q: 3. Look at the sequences below. If you add a restriction enzyme(that cuts at GAATTC) to the uncut…

A: as per our company guidelines we are supposed to answer only first 3 sub-parts. Kindly repost other…

Q: DNA A= 5' GGG GCT AGC CCC 3' DNA B=3' ATA TAT ATA CCC 5' DNA C= 5' TAC GTT ACG TCG 3' DNA D= 3' ATC…

A: A hairpin loop has a stem that contains complementary bases and a circular structure that does not…

Q: The technique of gel electrophoresis gives scientists an effective way to see some differences…

A: DNA stands for deoxyribonucleic acid. It is a double helix made up of two polynucleotide chains that…

Q: Figure 3: BestrictriOR site map showing the following: A) linear DNA that is not cut as reference B)…

A: Restriction enzymes cut the DNA (deoxyribonucleic acid) at specific sites. These enzymes recognize…

Q: In regards to satellite DNA, the major difference between a LINE sequence and a SINE sequence is the…

A: In molecular biology, there are two types of genes ,coding and noncoding. Coding genes helps in the…

Question

9. You have two tubes, each containing a different DNA fragment. The fragments are the same size but have
different, known sequences. The labels have worn off the tubes, so you don't know which tube is which.
How can you use restriction enzymes to determine which tube of DNA contains which fragment?

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

1. What is/are the purpose(s) of DNA extraction? 2. What is the function of each reagent used in the extraction of DNA from a banana? a. Saltwater b. Liquid dishwashing soap c. Cold isopropyl alcohol
1. The extraction of DNA is a common procedure in biotechnology research laboratories. Research the methods of extracting DNA in biotechnology facilities. Describe how the extraction methods used in this lesson compare to those of research laboratories.
1. How may recombinant DNA molecules be introduced into human cells? a. by splicing the needed genes into a mammalian chromosome using restriction enzymes. b. by adding plasmids to the mammalian cells. c. by using engineered viruses as vectors. d. by using a gene gun. 2. If someone is accused of a crime, investigators can collect his or her DNA to compare the DNA of the cells found at the crime scene. To collect human DNA, investigators often swab the inside of person’s cheek. Just a few human cheek cells contain enough material to perform PCR. In a cell, the nucleus and mitochondria contain DNA that is the starting material for PCR. Identify the 4 components needed to start a PCR reaction (equipment not included)
1. (a) Restriction sites are usually ______. Recombinant DNA Technology Restriction enzymes Ligase Palindromic sequences (b) Involves joining a donor DNA fragment of interest to a vector Recombinant DNA Technology Restriction enzymes Ligase Palindromic sequences
2. What does the salt in the soapy salt solution do in the DNA extraction? a. It dissolves the DNA. b. It displaced a lot of proteins to free the DNA. c. It disrupts the phospholipid bilayer. d. It precipitates the DNA.
9) The diagram to the right represents one technique used in biotechnology. The organic compound used to cut the bacterial DNA so that the human DNA could be inserted a(n)
2. Which of these statements is INCORRECT about restriction enzymes Restriction enzymes form phosphodiester bonds when DNA are assembled Palindromic sequences are recognized by restriction enzymes Restriction enzymes recognize blunt ends Restriction enzymes recognize sticky ends Restriction enzymes originated from bacteria
2)Which of the following is a correct representation of a segment of DNA: a) I b) I and III c) IV and V d) V and I
1. The enzyme that fills the gaps between the Okazaki fragments is ________. a.DNA polymerase b.Helicase c. Ligase d. Primase 2. After helicase unwinds the two DNA strands, ____________ bind to the single stranded DNA. This keeps the two single stranded DNA separated. a. Topoisomerase b. Single stranded binding proteins c. Ligae d. DNA polymerase 3. To synthesize a new strand of DNA, DNA polymerase requires: a. inorganic phosphate b.dNTPs (dATP, dCTP, dGTP, dTTP) c. a free 3' OH group d.ATP e. template DNA Please answer asap and type your answer and do not copy from anywhere please
27. You have a DNA sequence of 1400 bp. To characterize it, you decide to make a restriction map. Cutting with the first enzyme, you show by electrophoresis that the fragments produced are 400 and 1000 bp, respectively. After using the second enzyme, you recover 600-bp and 800-bp fragments. After treatment with both enzymes, fragments were 200, 400, and 800 bp. Draw the correct restriction map.
Some restriction enzymes produce DNA fragments with overhanging stretches called sticky ends on each strand. Sticky ends are useful in making recombinant DNA because Select one: a. Sticky ends contain the exact same nucleotides that allows fragments to splice together. b. Sticky ends contain nucleotides with complementary bases that allows fragments to splice together. c. Sticky ends contain the exact same nucleotides that can form hydrogen bonds. d. Sticky ends contain nucleotides with complementary bases that can form hydrogen bonds.
1. How can you modify your DNA model to reflect changes among DNA molecules? 2. How can a DNA molecule make an exact copy of itself?