(a) C1054 G530 A1493 A1492 $12 (b) C1054 TRNA G530 A1493 MRNA A1492 S12

Q: Introns in eukaryotic protein-coding genes are rarely shorter than 65 nucleotides in length. What…

A: In eukaryotes the template strand of DNA gets transcribed into pre-mRNA by the process known as…

Q: The following DNA nucleotides are found near the end of a bacterial transcription unit.…

A: The functions of DNA and RNA are controlled by genes. Genes are made up of a distinct collection of…

Q: Give 3 different tRNA anticodon sequences that could be mutated by a single base substitution into…

A: In transcription, mRNA takes the message from DNA to the cytoplasm for translation into proteins…

Q: The covalent attachment of an amino acid to a tRNA is an endergonic reaction. In other words, it…

A: Introduction  In the protein translation process, the key role is played by the tRNA which…

Q: Describe what two reaction steps are required for the formation of an aminoacyl-tRNA?

A: Transfer RNA, often known as tRNA, is a tiny RNA molecule that is essential for the production of…

Q: Describe the anticodon of a single tRNA that could recognize the codons 5′–AAC–3′ and 5′–AAU–3′.…

A: Ribonucleic acid (RNA) is a nucleic acid found in both the nucleus and cytoplasm. It can be genetic…

Q: What is the molecular weight of an mRNA that codes for the protein of molecular weight 75000KD?…

A: The translation is a process in which protein gets synthesized from mRNA template. It occurs in 3…

Q: . The genetic code is thought to have evolved to maximize genetic stability by minimizing the effect…

A: Arginine is coded by six mRNA codons.

Q: Phenylalanine (Phe) is encoded by either UUU or UUC, while Tyrosine (Tyr) is encoded only by UAC and…

A: Given  Phenylalanine (Phe) is encoded by either UUU or UUC, while Tyrosine (Tyr) is encoded only by…

Q: Are tRNAfmet and tRNAmet made from the same aminoacyl tRNA synthetase?

A: Amino acyl tRNA synthase pairs tRNA with amino acid that their anti codon codes for. Amino acyl tRNA…

Q: Explain why it is that the anticodon sequence AGG can bind to multiple different Serine codons. 2.…

A: The genetic codes are triplet of four bases ATGC and thus 43=64 codons are possible. These 64 codon…

Q: Remembering that the wobble base of the tRNA is the5′ base of the anticodon:a. In human tRNAs, what…

A: The anticodon of transfer ribonucleic acid is used for carrying the amino acids from the amino acid…

Q: Sixty-four different codons translate into only 20 amino acids. How are tRNAS adapted to address…

A: Hello Dear Students, Q: Answer: Most amino acids are specified by more than one codon in the genetic…

Q: Several experiments were conducted to obtain information about how the eukaryotic ribosome…

A: A ribosome is a biological unit made up of RNA and protein that functions as the cell's protein…

Q: . What is wobble base-pairing? According to Wobble's rule, one tRNA is sufficient to decode the…

A: Base pair is defined as two complementary nitrogenous that are connected by hydrogen bonds. Base…

Q: The protein Xpot transports tRNAs out of the nucleus so that they can be aminoacylated in the…

A: tRNA or transfer RNA is the RNA molecule that attaches to an amino acid as per the anticodon…

Q: Shown below is an R loop prepared for electron microscopy by annealing a purified eukaryotic…

A: An R-loop refers to a structure formed by a DNA (deoxyribonucleic acid) and an RNA molecule. As a…

Q: The wobble rules for tRNA-mRNA pairing are shown. If we assume that the tRNAs do not containmodified…

A: The pairing of tRNA anticodon with mRNA codon lead from the 5’ end of codon. The first 2 position…

Q: Consider the following tRNAs, where the numbered forms represent the amino acids associated with…

A: Transcription is the process  in which mRNA (messenger RNA ) is made from DNA which further…

Q: Which anticodon would you predict for a tRNA speciescarrying isoleucine? Is there more than one…

A: A codon can be defined as the three-nucleotide sequence present on the DNA or RNA which codes for…

Q: The following polynucleotide was synthesized and used as a template for peptide synthesis in a…

A: The DNA template is used to form an mRNA polynucleotide by the process of transcription. The mRNA…

Q: In prokaryotic protein synthesis, formylmethionine (fmet) is the first amino acid incorporated,…

A: Methionine which is a central molecule in one-carbon metabolism is an essential amino acid needed…

Q: When researchers obtain genomic sequence data from organisms with little known genetic information,…

A: The central dogma of life includes the following processes: Replication: In this process, the DNA…

Q: From this overall anticodon sequence in tRNA,…

A: Biological macromolecules are those large molecules that are necessary for the survival and growth…

Q: Although Ribosome binding site sequence vary considerably in different genes, they include examples…

A: Ribosome binding site (RBS) includes a sequence of nucleotide, which are present upstream the…

Q: How do the wobble rules affect the total number of different tRNAs that are needed to carry out…

A: The pairing of tRNA anticodon with mRNA codon lead from the 5’ end of codon. The first 2 position…

Q: Consider the tryptophan codon 5′ - UGG - 3′ in the standard genetic code . Can a single base change…

A: Deoxyribonucleic acid(DNA) is a molecule comprised of two polynucleotide chains coiled around each…

Q: The free energy of binding of codon on mRNA and anticodon on tRNA is -9 kT. What is the probability…

A: In thermodynamics, free energy is the function of internal energy, entropy, and enthalpy. The…

Q: The genetic code is thought to have evolved to maximize genetic stability by minimizing the effect…

A: Mutation is the alteration in the genome sequence. It can occur in the genetic code of eukaryotes,…

Q: Sickle-cell disease is caused by a so-called point mutation in the humanβ-globin gene. A point…

A: Two b-globin polypeptides combine with two a-globin polypeptides (encoded by another gene family)…

Q: The wobble pairing rule states that a 'U' in teh anticodon wobble position can pair with 'A' or 'G',…

A: Ribonucleic acid (RNA) is a nucleic acid found in both the nucleus and cytoplasm. It can be genetic…

Q: The BSA precursor protein is 607 amino acids long and has a molecular weight 69.324 kDa. If a…

A: BSA is globular proteins.  1kDa =  1.66 * 10-21 gm The molecular weight of BSA precursor protein is…

Q: A random-sequence polyribonudeotide produced by polynudleotide phosphorylase, with CDP and ADP in a…

A: Amino acids are coded by a tripeptide sequence called codons. The first two positions of the codon…

Q: Describe how the base pairing between the Shine–Dalgarno sequence and the 30S subunit provides a…

A: The translation represents the process of protein synthesis by which the base sequence of the mRNA…

Q: A short RNA molecule was isolated that demonstrated a hyperchromicshift , indicating secondary…

A: Answer- The formation of mRNA from the coding strand of the DNA is called translation. It happens in…

Q: Predict the amino acid sequence produced during translation by the following short hypothetical mRNA…

A: The alteration in the sequence of nucleotides of the genome of an organism is called a mutation.…

Q: Several experiments were conducted to obtain information about how the eukaryotic ribosome…

A: A ribosome is a biological unit made up of RNA and protein that functions as the cell's protein…

Q: The flu virus maximizes the use of its limited (13.5 kb) genome by using alternative translation…

A: Virus are mostly pathogenic forms which neither considered to be living or non-living outside the…

Q: Consider this nucleotide sequence of DNA strand in the image provided.  If this strand is the sense…

A:

Q: A double-stranded fragment of viral DNA, one of whose strands is shown below, encodes two peptides,…

A: A double-stranded fragment of viral DNA, one of whose strands is shown below, encodes two peptides,…

Q: An alanine residue exists at position 180 of a certain plant protein. If the codon specifying…

A: Substitution Replacement of one Nitrogenous base by another Nitrogenous base is called as…

Q: Several experiments were conducted to obtain information about how the eukaryotic ribosome…

A: Central dogma of life involves gene expression, or the flow of genetic information from genes to…

Q: Several experiments were conducted to obtain information about how the eukaryotic ribosome…

A: The start codon is the first codon of an mRNA (messenger RNA ) transcript translated by a ribosome.…

Q: Consider the wobble rules listed in Table 15.2. Which of the following mRNA codons will bind to the…

A: Protein translation is the process of molecular biology in which the mRNA synthesized by the process…

Q: Below is the sequence from the 3' end of an mRNA. S'..CCGUUACCAGGCCUCAUUAUUGGUAACGGAAAAAAAAAAAAAA-3'…

A: The eukaryotic premature mRNA is synthesized without the poly-A tail. The poly-A tail is added at…

Q: Given the following mRNA sequence: 5' GCCCAUGUGGCGCGAGUGAUUUAA 3' 1) Use the genetic code table…

A: Introduction The central dogma of molecular biology describes the flow of genetic information from…

Q: The unfinished peptide fMet-Arg-Ser-Tyr-Gln-Cys-Pro is held in the P-site of the 70S ribosomal…

A: As each consecutive complex of amino acid-tRNA attaches to the ribosome's A site, one GTP is…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.