A eukaryotic mRNA has 1066 total nucleotides. 50 of these are the 5'UTR and 50 of these are the 3'UTR. How many amino acids are in the protein encoded by this mRNA? Question 9 options: A) 319 B) 320 C) 321 D) 322 E) 323

A eukaryotic mRNA has 1066 total nucleotides. 50 of these are the 5'UTR and 50 of these are the 3'UTR. How many amino acids are in the protein encoded by this mRNA? Question 9 options: A) 319 B) 320 C) 321 D) 322 E) 323

Name: A eukaryotic mRNA has 1066 total nucleotides. 50 of these are the 5'UT
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: A eukaryotic mRNA has 1066 total nucleotides. 50 of these are the 5'UTR and 50 of these are the 3'UTR. How many amino acids are in the protein encoded by this mRNA?Question 9 options:A)319B)320C)321D)322E)323

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter10: From Proteins To Phenotypes

Section: Chapter Questions

Problem 20QP: If an extra nucleotide is inserted in the first exon of the beta globin gene, what effect will it...

See similar textbooks

Similar questions

How many amino acid are in each of the two polypeptides produced? And how many nucleotides long would the final processed mRNA made from the gene be?
How do we know that mRNA exists and serves as an intermediate between information encoded in DNA and its concomitant gene product?
How many nucleotides would be carried on a strip of mRNA with 10 codons?
A eukaryotic cell carrying out transcription and RNA processing is incubated with 32P-labeled ATP. Where will the radioactive isotope appear in mature mRNA if the ATP is labeled at the (a) α position, (b) β position, and (c) γ position?
For the following mRNA sequences, what is the amino acid sequence formed? Consult genetic code table for reference. 5' AGUCCGUAC 3' 5' AAUUGCUUC 3'
The fourth codon in an mRNA sequence is GGG, which specifies glycine. If we assume that no amino acids are removed from the polypeptide, which of the following statements is correct? a. The third amino acid from the N-terminus is glycine. b. The fourth amino acid from the N-terminus is glycine. c. The third amino acid from the C-terminus is glycine. d. The fourth amino acid from the C-terminus is glycine.
What polypeptide sequences would you expect to result from a synthetic mRNA with the repeating sequence 5’-UUUGGGUUUGGGUUUGGG-3'?
Translate the following mRNA nucleotide sequence into an amino acid sequence, starting at the first base: 5’ - UGUCAUGCUCGUCUUGAAUCUUGUGAUGCUCGUUGGAUUAAUUGU - 3’
If the mRNA transcribed for this gene will be translated into a functional protein, how many amino acids will be used to build the polypeptide chain? what is the amino acid coded by the 25th codon? what is the amino acid coded by the last codon?
If an extra nucleotide is inserted in the first exon of the beta globin gene, what effect will it have on the amino acid sequence of the globin polypeptides? Will the globin most likely be fully functional, partly functional, or nonfunctional? Why?
A certain mRNA strand has the following nucleotide sequence: 5AUGACGUAUAACUUU3 What is the anticodon for each codon? What is the amino acid sequence of the polypeptide? (Use Figure 13-5 to help answer this question.) Figure 13-5 The genetic code The genetic code specifies all possible combinations of the three bases that compose codons in mRNA. Of the 64 possible codons, 61 specify amino acids (see Figure 3-17 for an explanation of abbreviations). The codon AUG specifies the amino acid methionine and also signals the ribosome to initiate translation (start). Three codonsUAA, UGA, and UAGdo not specify amino acids; they terminate polypeptide synthesis (stop).
Translate the following mRNA nucleotide sequence into an amino acid sequence, starting at the second base: 5’ - UGUCAUGCUCGUCUUGAAUCUUGUGAUGCUCGUUGGAUUAAUUGU - 3’