Answered: A eukaryotic ribosome contains four…

A eukaryotic ribosome contains four diff erent rRNA molecules and ∼82 diff erent proteins. Why does a cell contain many more copies of the rRNA genes than the ribosomal protein genes?

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter30: Protein Synthesis

Section: Chapter Questions

Problem 10P: The Consequences of Ribosome Complexity Eukaryotic ribosomes are larger and more complex than...

See similar textbooks

Related questions

Q: A hypothetical base sequence of an RNA molecule is5′–AUUUGCCCUAGCAAACGUAGCAAACG–3′Make a drawing.

A: RNA stands for ribonucleic acid. It is a complex compound comprising of high molecular weight and…

Q: Eukaryotic genes are often interrupted by noncoding introns. What might be some possible reasons…

A: Introns comprise the non-coding sections of the RNA transcript or the DNA encoding it. These…

Q: A template strand in bacterial DNA has the following base sequence: 5′ –AGGTTTAACGTGCAT–3′ What…

A: Bacterial DNA is contained within the bacterial chromosome along with several RNA and protein…

Q: Create an mRNA strand based on the given DNA template strand: TACTTCCTATTTTCTTGTCA CCGCACT Using the…

A: The process of synthesis of RNA with the help of DNA is called transcription and the process of…

Q: Tell whether the following elements are found on DNA or RNA: a. -10 region b)e. poly(A) tai c).…

A: a) -10 region is found in DNA. it is also called pribnow box and is an essential part of a promoter…

Q: Why would 60S and 40S ribosomal subunits make an 80S ribosome rather than a 100S ribosome?

A: Ribosomes are the non-membrane bound cell organelles and these are responsible for the protein…

Q: Classify each of the terms describing ribosomal compoments as Eukaryotic or Bacterial, by dragging…

A: Eukaryotic cells bacterial cell 80 S ribosomes 70 s ribosomes 28s rRNA 23s rRNA…

Q: 2' HO 5' OH-3' -OH-3 |3' M O A represents Group I introns and B represents spliceosome introns O A…

A: Here,the answer is A represents Group II introns and B represents Group I introns. Group I and Group…

Q: Two eukaryotic proteins have one domain in common but areotherwise very different. Which of the…

A: Eukaryotes are organisms whose cells have a nucleus enclosed within a nuclear envelope. Eukaryotes…

Q: If the DNA duplex for the beta chain of haemoglobin 3'-TACCACGTGGACTGAGGACTCCTCTTCAGA-5' were…

A: Answer: TRANSCRIPTION = It is process of transcribing a strand of DNA using RNA polymerase which…

Q: In bacterial genes, as soon as any partial mRNA transcript is produced by the RNA polymerase system,…

Q: A researcher was mutating prokaryotic cells by inserting segments of DNA. In this way, she made the…

A: a.) Mutant is the palindromic sequence for original construct. Palindromic sequences are those…

Q: . The human gene for ß2 lens crystallin has the components listed below. The numbers represent…

A: Since we only answer up to 3 sub-parts, we’ll answer the first three. Please resubmit the question…

Q: Which type of ribosomal RNA is most often used in taxonomy?

A: Genes are the hereditary unit of an organism. The genes have DNA (deoxyribonucleic acid) which code…

Q: . In bacterial genes, as soon as any partial mRNA transcriptis produced by the RNA polymerase…

A: Messenger RNA (mRNA) molecules carry the coding sequences for macromolecule synthesis.

Q: Which of the following is not something commonly associated with eukaryotic MRNAS? 1. Splicing of…

A: Messenger Ribonucleic acid [m-RNA] is formed inside the cell by the process of transcription. The…

Q: Would a chimeric translation system containing thelarge ribosomal subunit from E. coli and the small…

A: The chimeric translation system is the translation process that uses two different ribosomal…

Q: An rRNA binds to a snoRNP that contains a C/D box snoRNA.What type of covalent modification would…

A: Small nucleolar RNAs (SnoRNAs) are metabolically stable RNAs that are abundantly present in…

A: The Central Dogma of Molecular Biology states that the genetic information stored in DNA is first…

Q: How many introns are present on a gene that consists of 01 The number cannot be determined from the…

A: Introns and exons are nucleotide sequences within a gene. Introns are removed by RNA splicing as RNA…

Q: DNA AGAGTTCTGCCCTGTCGATTT mRNA mino Acid Sequence Which kind of protein molecule did this gene make?

A: The order of amino acids from the amino-terminal to the carboxyl-terminal of a protein is generally…

Q: The human genome has 3.3 billion bases, of which 3% codes for protein. If a codon were four letters…

A: In most organisms, genetic information is stored in the form of the nucleotide sequence of DNA. This…

Q: What are the treatments that help the ribosome do it’s job in the treacher collins syndrome? And…

A: Introduction :- Treacher Collins syndrom is an rare genetic disorder .It is characterised by…

Q: A molecular geneticist hopes to find a gene in human liver cells that codes for an important…

A: The nucleotides sequence of the small part of the gene of interest is GTGGACTGACA as given in the…

Q: What structural features are shared by spliceosomes(Figures 8-16 and 8-17) and ribosomes? Why are…

A: Proteins are polymers of amino acids that have diverse roles.

Q: Some RNA molecules are covalently modifi ed by methylation at the N6 position in adenosine residues.…

A: Methylation of DNA is a process of covalent modification, in which at the adenosine nitrogenous…

Q: In prokaryotic protein synthesis, Nformylmethionine (fmet) is the first amino acid incorporated,…

A: Introduction: The process of protein synthesis from mRNA is called translation. The process of…

Q: Which rRNA plays a major role in the aligning of the transcript in the ribosome of prokaryotes? A.…

A: ribosomal RNA one type of RNA molecule in cells that forms part of the protein-synthesizing…

Q: Match the eukaryotic rRNA molecules with the proper ribosomal subunit. 55 FRNA [Choose ] 5.8S rRNA…

Q: C a 3' 5' exon intron exon intron exon intron untranslated region (UTR) coding sequence (CDS) Label…

A: Genes are the hereditary unit of an organism. It is inherited by the progeny from the parental…

Q: 1)HSP 70 is a chaperone protein that aids the folding of newly formed polypeptides during…

A: Introduction Translation is the process by which ribosomes in the cytoplasm or endoplasmic…

Q: In Tetrahymena, the removal of the single intron in the rRNA precursor does not involve a protein. O…

A: Central dogma includes three steps of transfer of genetic information which are replication,…

Q: If DNA segments changes from GCATAG to GCATGG, this is a: MRNA Codon/Amino Acid Chart First Base…

A: The DNA sequence GCATAG will have the mRNA code CGUAUC. When the sequence changed to GCATGG, then…

Q: . While perusing the E. coli K12 genome sequence,you come across a gene with no known function.…

A: Genome is defined as an organism’s complete set of DNA with all of its genes present. This will…

Q: In eukaryotic mRNA there are 90 nucleotide involved in translation process. What is the number of…

A: Gene expression is a process by which the genes are turned on to form RNA and proteins. This is seen…

Q: Here is a schematic map with a scale of a eukaryotic gene. How long is the primary mRNA transcript…

A: The mRNA is produced by the process of transcription.

Q: Describe the components of eukaryotic ribosomal subunits and the location where the assembly of the…

A: Ribosomes are small particles which of RNA and associated proteins that function to synthesize the…

Q: For the ovalbumin gene shown in Figure 14.3, where would the 5′ untranslated region and 3′…

A: Mature mRNA is an mRNA that is modified post-transcriptionally. Mature mRNA carries information from…

Q: Do rRNA and tRNA complementary base pair during prokaryotic protein synthesis? What about mRNA with…

A: Translation is the process which is responsible for protein synthesis. It takes places in the…

Q: The human genome contains about 500 genes fortRNAs.a. Do you think that each one of these tRNA…

A: Transfer- RNA or t-RNA is a type of non-coding RNA. It is transcribed with the help of an enzyme RNA…

Q: Given the mRNA sequence below, 5'-UUCCCAAAGUAU-3' Answer the following below: 1. What is the…

A: mRNA synthesis is carried out by the RNA polymerase enzyme. DNA acts as a template for the synthesis…

Q: Eukaryotic ribosome are 80S. What does ‘S’ stand for.

A: Eukaryotic cells are the ones that have membrane-bound organelles as compared to the prokaryotic…

Q: Name the type of mutation from the following choices: silent, missense, nonsense, frameshift. The…

A: CGA codes for Arginine. GGA codes for Glycine. Since the protein being coded for is completely…

Q: Which is the odd one out ? explain how the rest are related nucleoid cytoplasm RNA-binding protein…

A: Nucleoid can be defined as a region present in the prokaryotic cells,which contain genetic material.…

Q: 10.9 the beginning of a gene and five different mutations of this the base-pairing rules to complete…

A: A "nucleic acid" is a linear polymer of nucleotides that is a component of the cell's information…

Concept explainers

Microbial Taxonomy

Taxonomy is the science of naming, classifying, and describing organisms. The taxonomy will include all the plants, microorganisms, and animals on this planet. Carl Linnaeus coined the taxonomy term. He is known as the father of taxonomy. Microbial taxonomy is a criterion of grouping microorganisms into groups based on their similarities and past relatedness. Microorganisms belonging to the same group are differentiated from the others via grouping into categories. This differentiation makes the study of microorganisms easy. There are different types of microbial taxonomies like Numerical and Molecular taxonomy. The study of microorganisms is known as microbiology. Microbiology is a broad term that takes into account microbial cultures, taxonomic studies, evolutionary relationships. Microbial interaction and diversity are huge data that needs to be compiled under the subject of microbiology. Microbiology covers various organisms like bacteria, fungi, algae, plants, animals, etc.

Question

A eukaryotic ribosome contains four diff erent rRNA molecules and ∼82 diff erent proteins. Why does a cell contain many more copies of the rRNA genes than the ribosomal protein genes?

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

This is a popular solution!

SEE SOLUTION Check out a sample Q&A here

Introduction

VIEW

Reason for many copies of rRNA genes.

VIEW

Trending now

This is a popular solution!

Step by step

Solved in 2 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biochemistry and related others by exploring similar questions and additional content below.

Similar questions

The components of prokaryotic and eukaryotic ribosomes are shown in Figure 9-10. Based on this figure, do you think that the large prokaryotic ribosomal RNA(23S rRNA) would be able to substitute for the eukaryotic 28S rRNA? Justify your answer
Why would 60S and 40S ribosomal subunits make an 80S ribosome rather than a 100S ribosome?
What structural features are shared by spliceosomes(Figures 8-16 and 8-17) and ribosomes? Why are bothstructures used to support the RNA World theory?
. In bacterial genes, as soon as any partial mRNA transcriptis produced by the RNA polymerase system, the ribosome assembles on it and starts translating. Draw a diagram of this process, identifying 5′ and 3′ ends of mRNA,the COOH and NH2 ends of the protein, the RNA polymerase, and at least one ribosome. Why couldn’t this system work in eukaryotes?
What does polycistronic mean? For RNA or ribosomes
Assume a bacterial gene underwent a mutation, where a thymine base from an early portion of the coding sequence of the DNA is replaced with a cytosine (as illustrated below). Original sequence (coding strand): AGTTCCTACAAAATGGAGCTGTCTTGGCATGTAGTCTTT ...[Sequence continues with another 80 bases] New sequence: AGTTCCCACAAAATGGAGCTGTCTTGGCATGTAGTCTTT...[Sequence continues with another 80 bases] UAC encodes tyrosine, CAC encodes histine, per the coding table. (This question can be answered without use of the code table, but it is provided here as a resource.) What would the expected result of such a mutation be on the final protein product of the mutated gene (compared to the original, non-mutant product)? The protein will be very different from the original version, and likely non-functional. The protein will be cut short, ending after the first amino acid. There will be no protein produced at all. No change – the protein will be the same.…
Translate this RNA sequence into an amino acid sequence: 5'-AUG GGC UAC CGA-3'?
Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?
If the coding region of a gene (the exons) contains 2,100 base pairs of DNA, would a missense mutation cause a protein to be shorter, longer, or the same length as the normal 700 amino acid proteins? What would be the effect of a nonsense mutation? A sense mutation?
The Consequences of Ribosome Complexity Eukaryotic ribosomes are larger and more complex than prokaryotic ribosomal. What advantages and disadvantages might this greater ribosomal complexity bring to a eukaryotic cell?
Why is the position of the first AUG after the ribosome-binding site critical?
In bacterial genes, as soon as any partial mRNA transcript is produced by the RNA polymerase system, the ribosome assembles on it and starts translating. Draw a diagram of this process, identifying 5′ and 3′ ends of mRNA, the COOH and NH2 ends of the protein, the RNA polymerase, and at least one ribosome. Why couldn’t this system work in eukaryotes?