A novel, RNA-containing splicing factor is purified on the basis of its physical interaction with a previously known subunit of the spliceosome. You sequence the RNA within the new factor, and identify a region that is perfectly complementary to a stretch of the RNA from the previously known subunit with which it interacts. You suspect that the interaction between the new factor and the subunit is mediated by hybridization between these complementary RNA sequences, but would like to be sure. How could you test this experimentally?

A novel, RNA-containing splicing factor is purified on the basis of its physical interaction with a previously known subunit of the spliceosome. You sequence the RNA within the new factor, and identify a region that is perfectly complementary to a stretch of the RNA from the previously known subunit with which it interacts. You suspect that the interaction between the new factor and the subunit is mediated by hybridization between these complementary RNA sequences, but would like to be sure. How could you test this experimentally?

Biology Today and Tomorrow without Physiology (MindTap Course List)

5th Edition

ISBN:9781305117396

Author:Cecie Starr, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Christine Evers, Lisa Starr

Chapter7: Gene Expression And Control

Section: Chapter Questions

Problem 4CT

See similar textbooks

Similar questions

So the spliceosome is a structure that allows RNA splicing to occur, expelling the introns. Does this produce the coding sequences that ultimately generate the mature RNA? Does any malfunction within the spliceosome give rise to alternative splicing?
Knowing that the genetic code is almost universal, a scientist uses molecular biological methods to insert the human - globin gene (shown in the figure below (Links to an external site.)) into bacterial cells, hoping the cells will express it and synthesize functional - globin protein. Instead, the protein produced is nonfunctional and is found to contain many fewer amino acids than does -globin made by a eukaryotic cell. Explain why and give thoughts as to how to overcome this.
The interphase nucleus is a highly structured organelle with chromosome territories, interchromatin compartments, and transcription factories. In cultured human cells, researchers have identified approximately 8000 transcription factories per cell, each containing an average of eight tightly associated RNAP II molecules actively transcribing RNA. If each RNAP II molecule is transcribing a different gene, how might such a transcription factory appear? Provide a simple diagram that shows eight different genes being transcribed in a transcription factory and include the promoters, structural genes, and nascent transcripts in your presentation.
Shown below is an R loop prepared for electron microscopy by annealing a purified eukaryotic messenger RNA with DNA from a genomic clone containing the full-length gene corresponding to the mRNA. (a) How many exons does the gene contain? How many introns? (b) Where in this structure would you expect to find a 5′,5′-internucleotide bond? Where would you expect to find a polyadenylic acid sequence?
in the human gene for the beta chain of hemoglobin, the first 30 nucleotides in the amino acid coding region is represented by the sequence 3'TACCACGTGGACTGAGGACTCCTCTTCAGA-5'. What is the sequence of the partner strand? If the DNA duplex for the beta chain of hemoglobin above were transcribed from left to right, deduce the base sequence of the RNA in this coding region.
Shown below is a portion of a wild-type DNA sequence that encodes the last amino acids of a protein that is 270 amino acids long. The first three bolded base pairs indicate the frame and include the coding region. 5^ ...GCTAAGTATTGCTCAAGATTAGGATGATAAATAACTGG 3^ 3^.. CGATTCATAACGAGTTCTAATCCTACTATTTATTGACC 5^ Which strand is the template strand for transcription of this gene? Briefly explain how you know. An insertion of one base pair causes the protein to decrease in length by seven amino acids. With respect to the sequence given above, where does this insertion occur? A change of one base pair leads to the protein increasing in the length by one amino acid. With respect to the sequence given above, which base pair would you change, and what would you change this base pair for the protein to increase in the length by one amino acid?
In the splicing of group I introns shown, does the 5′ end of the intron have a phosphate group? Explain.
Although the genetic code is universal, a few organisms such as Paramecium have a slightly modified version in which UGA, a stop codon for most organisms, codes for tryptophan in Paramecium. Suppose that the researcher wanted to make an in vitro translation system using all of the components from Paramecium. Which of the components, if any, would she need to replace in order to have an in vitro system that was universal? Possible Answers: A. She would need to leave out the P site. B. She would need to leave out the termination factor proteins. C. She would need to leave out the tRNA that recognizes UGA. D. She would need to leave out the ubiquitin
What is a frameshift error? Does the binding of methionine tRNA to the small subunit help reduce frameshift errors? If so, how?
Shown below is a schematic drawing of a gene, with the transcription unit divided into numbered regions. The arrows (;) indicate transcription initiation sites, "D" indicates a splice donor site, "A" indicates a splice acceptor site, and "An" indicates a polyadenylation signal. Give all the possible fully processed mRNAs that could be produced from transcripts of this gene (you don't need to draw anything, just list the regions that would be included in each mRNA by number).
A gene contains eight sites where alternativesplicing is possible. Assuming that the splicing pattern at each site is independent of that at all other sites, how many splicing products are possible?
Introns in eukaryotic protein-coding genes may be quite large, but almost none are smaller than about 65 bp. What is the reason for this minimum intron size?