A sample of liver cells was collected from a healthy donor and from an individual with liver cancer. mRNA was isolated from both samples of cells and subjected to DNA microarray analysis. In the results from the two samples, 77 spots on the microarray from the cancer cells were much brightercompared to those for the cells from the healthy donor. How wouldyou interpret these results? Explain their meaning with regard to thegrowth of the cancer cells. (Note: Assume that each spot correspondsto a different gene.)

A sample of liver cells was collected from a healthy donor and from an individual with liver cancer. mRNA was isolated from both samples of cells and subjected to DNA microarray analysis. In the results from the two samples, 77 spots on the microarray from the cancer cells were much brightercompared to those for the cells from the healthy donor. How wouldyou interpret these results? Explain their meaning with regard to thegrowth of the cancer cells. (Note: Assume that each spot correspondsto a different gene.)

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 10QP: The pre-mRNA transcript and protein made by several mutant genes were examined. The results are...

See similar textbooks

Similar questions

Consider the retinoblastoma gene, which is 7,500bp long. If RNA polymerase can transcribe at the rate of 50 nucleotides/sec, how many retinoblastoma transcripts are produced in 10 minutes?
The pre-mRNA transcript and protein made by several mutant genes were examined. The results are given below. Determine where in the gene a likely mutation lies: the promoter region, exon, intron, cap on mRNA, or ribosome binding site. a. normal-length transcript, normal-length nonfunctional protein b. normal-length transcript, no protein made c. normal-length transcript, normal-length mRNA, short nonfunctional protein d. normal-length transcript, longer mRNA, shorter nonfunctional protein e. transcript never made
Although it is well known that X-rays cause mutations, they are routinely used to diagnose medical problems, including potential tumors, broken bones, and dental cavities. Why is this done? What precautions need to be taken?
Which of the following set(s) of primers a–d couldyou use to amplify the following target DNA sequence, which is part of the last protein-coding exonof the CFTR gene?5′ GGCTAAGATCTGAATTTTCCGAG ... TTGGGCAATAATGTAGCGCCTT 3′3′ CCGATTCTAGACTTAAAAGGCTC ... AACCCGTTATTACATCGCGGAA 5′a. 5′ GGAAAATTCAGATCTTAG 3′;5′ TGGGCAATAATGTAGCGC 3′b. 5′ GCTAAGATCTGAATTTTC 3′;3′ ACCCGTTATTACATCGCG 5′c. 3′ GATTCTAGACTTAAAGGC 5′;3′ ACCCGTTATTACATCGCG 5′d. 5′ GCTAAGATCTGAATTTTC 3′;5′ TGGGCAATAATGTAGCGC 3′
When a region of DNA that contains the genetic information for a protein is isolated from a bacterial cell and inserted into a eukaryotic cell in a proper position between a promoter and a terminator, the resulting cell usually produces the correct protein. But when the experiment is done in the reverse direction (eukaryotic DNA into a bacterial cell), the correct protein is often not produced. Can you suggest an explanation?
From your knowledge about DNA microarray, answer the following: If the expression microarray experiment was done with a normal sample and a suspected sample, after reading the color pattern resulted from the experiment it was recorded that “gene A22” is expressed in the suspected sample. The gene A22 is clinically linked to colon cancer. Answer the following: What is the expected color of the spot on the microarray which represents this gene? What is your interpretation of the suspected sample; is it a cancer sample or not and explain why?
A scientist seeks to synthesize a blood clotting factor protein in lab. To perform this experiment,she utilizes recombinant DNA technology where she inserts the gene of interest encoding for theparticular protein from a eukaryotic cell into bacterial plasmids. These plasmids are thesetransformed into E.coli for expression. During structural elucidation of the product, she isdisappointed to discover that the gene product from the bacteria is not the correct protein. Whatcorrective step could she take in the procedure to fix this issue? Justify your answer.
A strain of bacteria possesses a temperature-sensitive mutation in the gene that encodes the rho subunit. At high temperatures, rho is not functional. When these bacteria are raised at elevated temperatures, which of the following effects would you expect to see? Explain your reasoning for accepting or rejecting each of these five options. a. Transcription does not take place. b. All RNA molecules are shorter than normal. c. All RNA molecules are longer than normal. d. Some RNA molecules are longer than normal. e. RNA is copied from both DNA strands.
Upon identification of the DNA regulatory sequence responsible for translating a given gene, you note that it is enriched with CG sequences. Is the corresponding gene likely to be a highly expressed transcript?
What is the first step in quantifying the relative amounts of mRNA in different tissues? Would this method be useful in determining which immune system genes might be over-expressed in severe Covid cases? Why or why not? Could quantitative PCR, which uses a DNA-binding dye, to show how many copies of the target DNA sequence could be used to quantify the amount of mRNA in a cell? Would you expect that a metabolically active tissue such as the liver would show more cDNA copies in such a method, compared to less metabolically active tissues such as skin cells? One reason that the types and amounts of mRNAs are quantified in different tissue types is to compare which genes are activated and which are inactive. It used to be thought that any gene that was transcribed was automatically translated. The discovery of RNA-degrading systems shows that the real situation in cells is more complemented. Do you believe that a larger amount of mRNA of a given type, say for alpha hemoglobin in…
. Let’s say that you have incredible skill and can isolate the white and red patches of tissue from the Drosophila eyes shown in Figure 12-24 in order to isolate mRNA from each tissue preparation. Using your knowledge of DNA techniques from Chapter 10, design an experiment that would allow you to determine whether RNA is transcribed from the white gene in the red tissue or the whitetissue or both. If you need it, you have access to radioactive white-gene DNA
You are interested in studying a novel gene that appears to be involved in cancer. There is no information about the function of this gene. What would you do to obtain the cDNA for this gene? How would you express this gene and what expression systems might you utilize to study its function and why? How would determine the subcellular localization of this gene in eukaryotic cells? What are alternative methods in case one doesn't work? How would you purify and determine the 3-dimensional structure of this protein?