TAG CCG ATA GCT TGA Translate the gene above into a protein .  Please write the three letter code of the third amino acid in the sequence in the blank.

Q: The following sequence represents the dsDNA code for a short peptide 5' -CTT TCC CAT CAC CGC ATG…

A: 3= No , it is not possible for codon to code for another amino acid . 4= UAA is a stop codon , if…

Q: If the DNA gene reads AAT GGT CCA CCG CTG, what will the MRNA read? O A. TTA CCA GGT GGC GAC O B.…

A: DNA is a macromolecule and is composed of nucleotides having sugar , phosphate and nitrogenous bases…

Q: In the diagram below, identify the mRNA by clicking on the correct highlighted portion. TACGGGCTA A…

A: Alleles are considered as the variant of the gene. DNA is composed of different nucleotides that…

Q: Examine the following coding strand DNA nucleotide sequence,representing the complete gene sequence…

A: Note: As per Bartleby Guidelines For Remaining Answers Please Repost The Question. Introduction: A…

Q: Refer to Figure 9.7, then translate the following mRNA nucleotide sequence into an amino acid…

A: Ribonucleic‌ ‌acid‌ ‌(RNA)‌ ‌‌also‌ ‌contains‌ ‌genetic‌ ‌material‌ ‌but‌ ‌rarely‌ ‌takes‌ ‌part‌…

Q: Given the following mRNA codons and amino acids, construct a polypeptide from this DNA strand.…

A: Central dogma is the process where in the information stored in nucleic acids is transferred to…

Q: Complete the tables below to determine the polypeptide chain of a functional and mutated hemoglobin…

A: 1st Six Codons of the Functional Hemoglobin Gene... DNA.. GTG CAC CTG ACT CCT GAG  mRNA codon is ..…

Q: For each of the following sequences, fill in either the DNA, the MRNA sequence, or the amino acid…

A: The central dogma is referred as the central processing system which includes the transfer of…

Q: Coding DNA 5’- GTG ACT CGT TGT GCC ATT GCA GCT AAA CAC TTC GAG CCC TGT- 3’ mRNA 5’- GUG ACU CGU UGU…

A: A genetic code translates the genetic information encoded within the deoxyribonucleic acid (DNA) or…

Q: The coding strand of a mutant gene A allele is shown below. On the space provided, type the…

A: The translated product of mutant gene will contain the amino acid synthesized from the transcribed…

Q: TRANSLATE this RNA sequence: AUGCAAUGA Met-Gln-Stop Met-His-Stop O Thr-Glu-Stop O Thr-Pro-Stop

A: We’ll answer the first question since the exact one wasn’t specified. Please submit a new question…

Q: Using the table above and the mRNA transcript AUG-CUC-UAC-AAG-UAG, choose the false statement: XXX…

A: Nucleic acids are involved in various processes in the cell, their main role is the expression of…

Q: Name the type of mutation from the following choices: silent, missense, nonsense, frameshift. The…

A: Mutations are sudden heritable changes in the nucleotide sequence of a gene that changes the amino…

Q: CUGACUGACUGA A template strand of DNA in a gene reads: TGG CTG GGT GCT ACA. GUCAGUCAGUCA Using the…

A: Firstly DNA template strand undergoes transcription process to form RNA. After that translation…

Q: The DNA sequence of the coding strand is shown below; which reading frame most likely codes for a…

A: Start codon in translation is AUG in RNA and ATG in the DNA sequence that codes for methionine amino…

Q: Complete the table below: DNA DNA Complimentary Strand  mRNA sequence  tRNA sequence  Amino…

A: Deoxyribonucleic acid is a molecule composed of two polynucleotide chains that coil around each…

Q: Part of the protein-coding region in a gene has the base sequence 3-…

A: Adenine (A), cytosine (C), guanine (G), and thymine (T) are the four nucleotides that makeup DNA…

Q: The coding sequences of Gene F and Gene G are shown by the double-stranded DNA below. What is the…

A: A DNA sequence is transcribed to produce messenger RNA (mRNA) which is a link between DNA and…

Q: The following is the DNA sequence of the entire protein-coding region for some small gene in a…

A: The flow of information from DNA to RNA is known as Transcription. (a) Transcription: It is a…

Q: A template strand of DNA in a gene reads: ATGGCTGGGTGCTTTTAA. Using the codon chart provided, what…

A: The template DNA strand, from which the mRNA is synthesized is as follows, 5' ATGGCTGGGTGCTTTTAA3'…

Q: using the genetic code provided what would be the corresponding polypeptide sequence for the DNA…

A: DNA is a double helical complex molecule which encodes all the information regarding an organism. It…

Q: Given the template DNA sequence:  3’ - TAC - CAG - GTT - ACC - ATC - 5’    A.) What will be the…

A: Note : Hi ! Thank you for the question. We are authorized to answer three subparts at a time. Since…

Q: Write a mRNA sequence for the below nucleotide sequences ATTACACACAGCGCGTATACGCGCGCGGGCTATA

A: The mRNA sequence is considered the template strand used to form the chain of amino acids. A codon…

Q: Give the mRNA and amino acid sequence from this DNA strand: TACATACCTCGGCTTTGGCTGAAAGGTACTTATAATGCT

A: By the process of transcription the DNA strand is transcribed into mRNA within the nucleus of the…

Q: Translate the following mRNA into protein, starting from the first initiation codon:…

A: Translation is the process of synthesis of protein from an mRNA. mRNA synthesized through…

Q: A Section of a Gene CTA AAA TAG TCT For the DNA sense strand sequence shown above, identify the…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: CGG CCA UGU AUA UAA Enter your answer as a string without dashes, using three-letter abbreviations…

A: DNA ( Deoxyribonucleic acid) is a ladder like helical structure which serves as genetic material in…

Q: Provide the DNA sequence (not RNA sequence) for the Start Codon and 3 Stop Codons.

A: The genetic code is a set of rules that living cells use to convert information found in genetic…

Q: For the messenger RNA sequence below, find the beginning of the amino acid coding sequence and…

A: Translation is a technique which refers to the process of translating mRNA sequence into amino acid…

Q: sectio (b) The standard (coding strand) base triplets TAA, TAG an TCA do not correspond with an…

A:

Q: The following segment of DNA codes a protein. The uppercase letters represent exons, the lowercase…

A: Introduction Translation is the process by which ribosomes in the cytoplasm or endoplasmic reticulum…

Q: ermine the sequence of amino acids specified by the codons in the following information strand. G…

A: The synthesis of RNA with the help of the DNA strands is called transcription and the translation is…

Q: The tollowing mRNA transcript would result in which polypeptide sequence? 5'-ACU UUC ACU AUG UUU UUA…

A: Protein consists of amino acids linked by amide bonds or peptide bonds.

Q: Need help to answer the following questions. Not sure if my answers are right.

A: DNA has a double helix structure. Both the strands are antiparallel that is if the one strand has 3'…

Q: Using a codon table, complete the DNA triplets, mRNA codons, tRNA anticodons, and amino acids in the…

A: Genetic code is in triplets and the codes are read by the anticodon and thus the amino acids are…

Q: A. Below is a small 2 exon long gene. The exons are underlined, and the 22 nucleotide long intron is…

A: Given is a DNA template with a sequence and it consists of two exons and introns in it.Exons are the…

Q: Translate this RNA sequence into an amino acid sequence: 5'-AUG GGC UAC CGA-3'?

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: A. Below is a small 2 exon long gene. The exons are underlined, and the 22 nucleotide long intron is…

A: "Since you have posted a question with multiple sub-parts, we will solve the first three sub-parts…

Q: Using the table of genetic code, choose the CORRECT protein sequence that will be produced from the…

A: Genetic code is a triplet code called a codon. There are 64 codon out of which three codon do not…

Q: Lgh ndrome is a metabolic disorder that affects the cetral nervous system a mutation in the MT-ATP6…

A: Proteins are synthesized from mRNAs through translation. mRNAs are synthesized through…

Q: A gene contains the sequence CGCATACGGTAC that results in the amino acid sequence arg-ile-arq- tyr.…

A: The DNA (deoxyribonucleic acid) codes for the peptide chain via transcription and translation. mRNA…

Q: A template strand of DNA in a gene reads: CCA AGC TCT. Using the codon chart provided, what is the…

A: Translation:  Translation is the process by which ribosomes in the cytoplasm or endoplasmic…

Q: ction of a Gene AAG ATA CAG GCT CGG TAA For the DNA sequence shown above, identify the following:…

A: AAG ATA CAG GCT CGG TAA : DNA

Q: Below is a small 2 exon long gene. The exons are underlined, and the 22 nucleotide long intron is…

A: Untranslated regions are present in RNA which are transcribed but not translated on either end of…

Q: Draw a typical bacterial protein-coding gene; label the important portions of the gene and the…

A: Answer:Introduction: Gene duplication is considered to be the general method to make new genes, but…

Q: Write the mRNA sequence (5′ to 3′) that would result from transcription of the DNA sequence. (Note:…

A: Deoxyribonucleic acid or DNA is the type of nucleic acid present in the nucleus of the cell. It is…

Q: Name the type of mutation from the following choices: silent, missense, nonsense, frameshift. The…

A: CGA codes for Arginine.  GGA codes for Glycine.  Since the protein being coded for is completely…

Q: Indicate the mRNA sequence, coding sense DNA sequence and template DNA sequence that produced the…

A: Though it is easier to decide the sequence of amino acids from a given segment of either DNA (any…

Q: CTA GCC CTC CGT TAC TAG TTA CCT ACT TAT TCA ATT TTG TAA ACG CTC ATC CGA ACC CGC TTT TAA TTG CCC ACT…

A: The process of synthesizing mRNA strand with the help of template stand of DNA is called…