A protein is normally secreted from the cell. A team of scientists attempts to redirect thisprotein to the inside of the nucleus by mutating the sequence of the gene. Unfortunately,after this mutation, the protein is no longer secreted, but it is now localized to the cytosoland not the nucleus. Briefly answer the two questions below:Identify the sequence that was mutated by the scientists and explain your reasoning.a.b. What additional mutation must be made by the scientists to redirect this protein to thenucleus? Explain your reasoning.

Name: A protein is normally secreted from the cell. A team of scientists at
Uploaded: 2024-03-20T06:42:55.000Z
Channel: Bartleby
Description: A protein is normally secreted from the cell. A team of scientists attempts to redirect thisprotein to the inside of the nucleus by mutating the sequence of the gene. Unfortunately,after this mutation, the protein is no longer secreted, but it is no

Ans) a)A mutant protein is the protein product encoded by a gene with mutation. Mutated protein can…

Science

Biology

a. Identify the sequence that was mutated by the scientists and explain your reasoning. b. What additional mutation must be made by the scientists to redirect this protein to the nucleus? Explain your reasoning.

a. Identify the sequence that was mutated by the scientists and explain your reasoning. b. What additional mutation must be made by the scientists to redirect this protein to the nucleus? Explain your reasoning.

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter11: Genome Alterations: Mutation And Epigenetics

Section: Chapter Questions

Problem 10QP: If the coding region of a gene (the exons) contains 2,100 base pairs of DNA, would a missense...

See similar textbooks

Similar questions

One important biological effect of a large dose of ionizing radiation is to halt cell division. What might be the effects of such a mutation if the cell is not irradiated?
X-rays strike a chromosome in a living cell and ultimately cause the cell to die. Did the X-rays produce a mutation? Explain why or why not.
What happens when one base pair of DNA is lost from the coding region of a gene because of mutation? First explain how this would affect the mRNA sequence, and second, explain how this would alter the amino acid of the protein that is encoded.
A mutation occurred that changes the sequence of DNA from: 5’ACGTCATGGATAGTGCGTAAACTA3’ to 5’ACGTCATGCGATAGTGCGTAAACTA3’ Describe the effect of this mutation on the protein, and give the name of the type of mutation.
If the coding region of a gene (the exons) contains 2,100 base pairs of DNA, would a missense mutation causes a protein to be shorter, longer, or the same length as the normal 700 amino acid proteins? What would be the effect of a nonsense mutation? A sense mutation?
Refer to the double stranded DNA molecule with the sequence below to answer the following questions: 5’ATATGGGTCTCGATAGGGCTGTTTTCTCCGGC 3’ 3’TATACCCAGAGCTATCCCGACAAAAGAGGCCG 5’ Which strand functions as the transcription template, the top one or the bottom one? Explain your reasoning. What is the mRNA transcript and polypeptide from this strand? In the space below, copy the DNA strand that is transcribed, and write the mRNA transcript and polypeptide chain below it. Align the mRNA and polypeptide so that it is clear which DNA bases they came from. DNA strand: mRNA: amino acid sequence:
In a particular region of the genome of a certain bacterium, one DNA strand is transcribed to give rise to an mRNA for protein A and the other DNA strand is transcribed to give rise to an mRNA for protein B. a) Would there be any problem in expressing the two genes? 2. b) If a mutation occurred to affect the structure of protein A, what would you observe in the structure of protein B?
A mutant strain of bacteria is isolated in which the amino acid glutamine is often erroneously substituted for glutamic acid during protein synthesis. What kind of mutation might be underlying this defect? How could you test this hypothesis?
If the sequence of an mRNA is GAGUUCACAGUAGGC, the sequence of the template strand of the corresponding gene is... which of the following answers? a. CTCAAGTGTCATCCG b. GCCTACTGTGAACTC c. 3' GAGTTCACAGTAGGC 5' d. GAGTTCACAGTAGGC e. none of the above
A scientist observing a cell during gene expression would be able to easily distinguish it as a prokaryotic cell by which of the following observations? Group of answer choices as soon as the DNA introns are removed from the template after the 5' caps are converted to mRNA after a transcription initiation complex has been formed during transcription once the pre-mRNA has been converted to mRNA 2. Which of the following would best ensure that a kidney cell and a liver cell from the same person would express different genes? Group of answer choices differences in introns unique sets of transcription factors they only have specific genes unique sets of promoters
Some bacteria might be able to respond to environmental stress by increasing the rate at which mutations occur during cell division. How might this be accomplished? Do you think there would be an evolutionary advantage of this ability? Explain.
(a) Write the sequence of the mRNA molecule synthesized from a DNA template strand having the following sequence:5'–ATCGTACCGTTA–3' (b) What amino acid sequence is encoded by the following base sequence of an mRNA molecule? Assume that the reading frame starts at the 5’ end.5'–UUGCCUAGUGAUUGGAUG–3! (c) What is the sequence of the polypeptide formed on addition of poly(UUAC) to a cell-free proteinsynthesizing system?