a. Which of the following is NOT an example of structural polysaccharides? I. amylose II. cellulose III. chitin   b. Which of the following is the epimer of glucose at C-2? I. gulose II. galactose III. mannose IV. fructose V. talose

Q: You are trying to annotate a new phage genome; which program or programs should you use to determine…

A: Phamerator is computational tool that is designed to sort out phage genes into phage families of…

Q: Neutrophils exhibit a respiratory burst of free radicals and strong oxidizers during acute…

A: Free radicals are highly energetic chemical species that go onto react with almost anything.…

Q: henylalanine pell out the full name of the citric acid cycle Intermediate. If there ls more than one…

A: PKU patients can suffer from intellectual disabilities, brain damage, seizures, and other problems…

Q: 1. What are the functions of carbohydrates?

A: Since you have posted multiple questions we will solve the first question for you. If you want any…

Q: _____ 1. is the classification of enzyme where carbonic anhydrase belong ______ 2. is the name of…

A: The reaction catalyzed by carbonic anhydrase is given below. H2O + CO2⇌ H2CO3 ⇌ HCO3- + H+. The…

Q: pls help ASAP, thanks!

A: In the anaplerotic reaction the oxaloacetate metabolite is converted to PEP by the PEP carboxykinase…

Q: - Multiple Choice - Explain your answer in 3-5 sentences. - answer properly QUESTION: Which of the…

A: The enzyme which catalyze the ADP-ribosylation of key cellular enzymes or proteins? Answer a.…

Q: rganic molecules were originally named so, because they were thought to only be produced by living…

A: In biochemistry, organic compounds are generally any chemical compound that contain carbon atom, all…

Q: Long explanations are not needed.  True or False a. One NADH is produced for every pyruvate…

A: The pentose phosphate pathway is an alternative pathway for glucose oxidation. It provides NADPH for…

Q: What is the MAJOR product of the reaction catalyzed by rubisco in the Calvin cycle? Select one:

A: The Calvin Cycle is the part of the light independent reactions of photosynthesis, that widely uses…

Q: Angiotensin-converting enzyme inhibitors (ACE inhibitors) are used to treat high blood pressure.…

A: ACE is an enzyme in the Renin-Angiotensin-Aldosterone pathway (RAAS).  ACE inhibitors (ACE I)…

Q: Which exemplifies substrate level phosphorylation? O Glucose + ATP --> Glucose-6-phosphate…

A: Substrate-level phosphorylation is a metabolism reaction that aids in the transfer of a phosphate…

Q: In preparation of the ELISA plates, an albumin protein (BSA) was used to "block" the plate after the…

A: Introduction: Enzyme-linked immunosorbent assay is a quantitative immunological technique in which…

Q: deoxynucleosides?

A: Nucleosides and deoxynucleosides are endogenous metabolites excreted from RNA turnover and DNA…

Q: ACTIVITY 6.2.4 Give the systematic name of the following cyclic monosaccharides: 1. Name: OH Н OH Н…

A: Monosaccharides are carbohydrates with single sugar unit. The structure of monosaccharides can be…

Q: In a process of production of a recombinant protein by E. coli cells, it was observed accumulation…

A: Chemical compounds and recombinant proteins are frequently produced commercially using Escherichia…

Q: Based on the knowledge you gained from the cloning module, which of the bands in gure is associated…

A: A clone is a copy of a cell or organism that is genetically identical to the original. Clone…

Q: depletion of NAD+

A: Nicotinamide adenine dinucleotide ( NAD) is a coenzyme central to metabolism. It is found in all…

Q: 1. Name and draw diagrammatically the series of mitochondrial electron transfer catalysts, starting…

A: Since you have posted multiple questions we will answer the first question for you. If you want the…

Q: Which of the following statements about protein digestion are true? Check all that apply. ► View…

A: Proteins are macronutrients, which act as the building blocks of the body. Proteins can also act as…

Q: Which of the following is least soluble in hexane?

A: Fatty acids (FA) are aliphatic chain with carboxylic acid group, which is non-polar molecule. This…

Q: 9. Which of the following changes would not affect a peptide GENSHIN? A. Heat B. Inorganic Salts C.…

A: Proteins are unbranched polymers constructed from 20 standard α-amino acids. They have four levels…

Q: what is the role of amino acids in purine metabolism?

A: Purine metabolism is described as a process in which different metabolic pathways are followed so as…

Q: Polyunsaturated fatty acids a). are solid at room temperature b). have carbon-carbon double bonds…

A: Fatty acids are carboxylic acids with long hydrocarbon chain. There are two types of fatty acids -…

Q: Removal of phosphoryl groups is catalyzed by ___________ a. Diphteria toxin and cholera toxin b.…

A: The phosphoryl-transfer potential (the standard energy of hydrolysis) compares the proclivity of…

Q: When weighing the protein at the end of the activity, what major assumption is made about the…

A: Casein is a protein present in milk that contributes to the white colour of the milk. Cow's milk…

Q: The lipophilic compounds do not interact with any chiral receptors within the cell membrane, and it…

A: Lipophilicity is a key assets in processes, along with intestinal absorption, membrane permeability,…

Q: What is the difference between the first steps of DNA sequencing to PCR in terms of the number of…

A: PCR is expanded as a polymerase chain reaction. It is a technique that is used widely for the…

Q: A) For this DNA fragment "TGAATTCCCGGGTTCCGGGAATTCGCGCGAATTCCCGGTATA", what is its complementary…

A: Deoxyribonucleic acid (DNA) is a nucleic acid that carries genetic information from parent to…

Q: The compound below which is labelled in two positions with 13c (as represented by the shaded…

A: Glycolysis is a catabolic pathway in which glucose is oxidized to two molecules of pyruvate in the…

Q: 5 Write equilibrium expressions for these reactions. (a) 2H,0,(g)=2H,0(g) + O,g) (b) 2N,0,(g)=…

A: Introduction: A number that relates the concentrations of the beginning compound and products of a…

Q: ADP molecules phosphate molecule intermembrane space ATP synthase H+ ions CoQ mitochondrial matrix…

A: A widely accepted model for ATP synthesis is the binding change mechanism or flip-flop…

Q: What is the total number of ATP molecules that can be produced from the complete oxidation of one…

A:

Q: what color will cellulose turn for iodine test?

A: Cellulose is an important component of cell wall of plants. It is a Polysaccharide made up of beta D…

Q: Problem 2. Competitive inhibitors are commonly used to make pharmaceuticals. Some cancer drugs act…

A: We need to plot the Lineweaver Burk Plot (LB Plot) to solve this problem. So first we need to find…

Q: Aldolase enzymes have the following rate constants. k₁ = 10³M ¹s¹, k-₁ = 4.4x10 s ¹, k₂ = 10's-¹ -1…

A: Consider the following single substrate (S) enzyme (E) catalyzed reaction mechanism given below E +…

Q: Place the events for glycolysis in the correct order. Formation of fructose-1,6-bisphosphate A…

A: Glycolysis is a process in which one mole of glucose is break down into two moles of pyruvate. It…

Q: One treatment for hyperuricemia is administration of xanthine oxidase inhibitors like  allopurinol.…

A: Hyperuricemia means a high concentration of uric acid in the blood. Hyperuricemia results in gout…

Q: Failure of anti-oxidant function results in the hydroxylation of an aromatic acid of Enzyme Z and…

A: Sanger DNA sequencing is carried out using ddCCTP for the chain termination. The given peptide is…

Q: interphase FISH is used on fixed material from a solid tumour, rather than metaphase FISH

A: Interphase FISH is a new technique introduced into the molecular cytogenetics. it is used to study…

Q: What does the term ’leakage’ mean in the context of regulating greenhouse gas emissions? and why is…

A: Carbon leakage refers to a scenario in which a agency makes a decision to transport their…

Q: Why is fumarate hydrated? To enable it to interact with an enzyme O To form a double bond To reduce…

A: Introduction: The citric acid cycle is the final common pathway for the oxidation of various…

Q: ACTIVITY 6.2.6 Give the complete name of the disaccharides below: 1. Lactose 2. Cellobiose

A: Essentially, a disaccharide is made up of two monosaccharides (simple sugars) linked together. A…

Q: Translation in eukaryotes and prokaryotes are similar and yet different. From a therapeutic…

A: Translation is the process where mRNA transcript of a particular gene is decoded to give rise to a…

Q: what is the relative activity and the degree of inhibition caused by a competitive inhibitor when…

A: Enzymes are biocatalyst that increases the speed of reaction by lowering the activation energy.…

Q: ACTIVITY 6.1 Complete the table below Source Example of Carbohydrate Function

A: Carbohydrates are a form of macronutrient that can be found in a variety of foods and drinks.…

Q: 30. assicuatuib if 2alpha and 2 beta chains to form adult hemoglobin

A: HbA2 is a gene that in encodes for the alpha globin chain of haemoglobin in humans.

Q: Problem 1 Yeast cells has been cultured on glucose (Table 1). The growth data follows the Monod…

A: The Monod equation for cell growth kinetics is given below; μ = μmax [S]Ks + [S] here 'μ' is…

Q: BRIEFLY EXPLAIN their BIOLOGICAL SIGNIFICANCE of Cellulose and Chitin

A: Polysaccharides consist of repeated units of monosaccharides or the derivatives of monosaccharides…

Q: To set up a standard curve you would have had to set up a dilution series. Draw up a table showing…

A: Serial dilution is the process of converting a dense solution towards a more useable concentration…