An unknown virus called Tricky had 23 % cytosine residues. Find out the percent of different bases in Tricky's genetic material. Use the word unknown where the percent of a particular base cannot be determined. If the genetic material of Tricky is a double stranded DNA, it will have % A, % G, % T and % U. i If the genetic material of Tricky is a double stranded RNA, it will have % A, % G, % T and % U. If the genetic material of Tricky is a single stranded DNA, it will have % A, % G, % T and % U.

An unknown virus called Tricky had 23 % cytosine residues. Find out the percent of different bases in Tricky's genetic material. Use the word unknown where the percent of a particular base cannot be determined. If the genetic material of Tricky is a double stranded DNA, it will have % A, % G, % T and % U. i If the genetic material of Tricky is a double stranded RNA, it will have % A, % G, % T and % U. If the genetic material of Tricky is a single stranded DNA, it will have % A, % G, % T and % U.

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter29: Transcription And The Regulation Of Gene Expression

Section: Chapter Questions

Problem 19P: Figure 29.15 highlights in red the DNA phosphate oxygen atoms. Some of them interact with catabolite...

See similar textbooks

Similar questions

Given the following DNA sequence: 5’-ATGCGGCCAAGGTCAGAGTGACA-3’ a) If this DNA strand represents the “Sense Strand” of DNA, what would be the RNA sequence? b) If this DNA strand represents the “Antisense Strand” of DNA, what would be the RNA Sequence? c) What would be the other strand of DNA?
The following is a section of DNA removed from a cell nucleus:5' ATGAAATAATCAGTTAACAGCAGVFCCGATTTTTATACT 3'strand 3' TACITTATTAGTCAAVFGTCGTCAAGGCTAAAAATATGA 5'strand a. What does the Central Dogma state? b. Label the strands above as the "sense" or "antisense" strand. c. Using the chart below, transcribe ONLY the gene into mRNA and then translate the gene into its amino acid sequence, d. What would happen to the gene if the adenosine mutates to a thymine where the arrow indicates? 3' TACTTTATTAGTCAATTGTCGTCAAGGCTAAAAATATGA 5' What type of mutation is this?
The following diagram of a generalized tetranucleotide will serve as a basis for the three questions marked “a” through “c.” (02) (a) Is this a DNA or an RNA molecule? State which _________ (b) Place an “X” (in one of the circles provided) at the 3' end of this tetranucleotide. (c) Given that the DNA strand, which served as a template for the synthesis of this tetranucleotide, was composed of the bases 5'- A C A G - 3', fill in the parentheses (in the diagram) with the expected bases
A template strand in bacterial DNA has the following base sequence: 5′ –AGGTTTAACGTGCAT–3′ What amino acids are encoded by this sequence?
A nontemplate strand of bacterial DNA has the following base sequence. What amino acid sequence will be encoded by this sequence? 5′ –ATGATACTAAGGCCC–3′
In proteins, a peptide read from the N terminal to the C terminal. Is there a kind of direction in DNA/RNA as well? Briefly explain. What does Chargaff’s rules mean? Who proposed DNA was a double helix? In what decade? If one DNA single strand has the sequence 5’-AATGCAA-3’, what is the sequence of its complementary strand? When DNA replicates, how is it able to “unwind” its double helix?
Total nucleic acids are extracted from a growing culture of yeast cells. They are then mixed with specialized beads to which the single-stranded DNA molecule with sequence 5’-TTTTTTTTTTTTTTTTTTTTTTTTT-3’ has been covalently attached to the surface (see image to the right, where each black line represents a polynucleotide sequence). After a short incubation time, the beads are removed from the mixture. When you analyze the cellular nucleic acids stuck to the beads, which type of nucleic acid (i.e. DNA, rRNA, etc.) do you expect to be the most abundant? Why?
Consider the following DNA sequence:CATGTGTAGTCTAAAa. Write the sequence of the DNA strand that would be repli-cated from this one.b. Write the sequence of the RNA molecule that would betranscribed from the DNA strand.c. State how many codons the sequence specifies.d. State how many amino acids the sequence specifies
Which of the following sequences on a DNA moleculewould be complementary to GCTTATAT?a. TAGGCGCGb. ATCCGCGCc. CGAATATAd. TGCCTCTC
One strand of a double-helical DNA has the sequence (5’)GCTCAATATTTCTCAAAAT ATTGCGC(3’). Write the base sequence of the complementary strand. What special type of sequence is contained in this DNA segment?
Which of the following relations or ratios would be true for a doublestranded DNA molecule? a. A + T = G + C b. A + T = T + C c. A + C = G + T d. A + TC + G = 1.0 e. A + GC + T = 1.0 f. AC = GT g. AG = CT h. AT = GC
Which of the following strands of DNA (assuming it was bound to its complementary strand to create a double-helix structure) would be the least difficult to break apart? a. 5' - CCGCCGGCATATCCGAT - 3' b. 5' - CCGCGCGATCGGCGCGT - 3' c. 5' - AATGAGGCCAATTGACA - 3' d. 5' - CCACCAGGCACAGCCGA - 3' e. 5' - AAATTGATATATAGGCA - 3'