As we focused on the translation of mRNA into proteins as well as on protein structure and function. Along the way, we found many opportunities to consider the methods and reasoning by which much of this informationwas acquired. From the explanations given in the chapter,what answers would you propose to the following fundamentalquestion What experimentally derived information led to Holley’sproposal of the two-dimensional cloverleaf model of tRNA?

Q: peptide bond formation is catalizyed at the larger ribosomal subunit. does this happend in…

A: Translation includes three phases: initiation, elongation, and termination. Initiation is a phase in…

Q: How will you best describe tRNA, support your answer with a proper diagram?

A: Ribonucleic acid (RNA) is a polymeric molecule essential in various biological roles in coding,…

Q: The genetic code was deciphered by experiments in which synthetic polyribonucleotides of known…

A: Hi dear, here's your answer.please like it .

Q: A short RNA molecule was isolated that demonstrated a hyperchromic shift indicating secondary…

A: Ribonucleic acid (RNA) is a single-stranded polymer of ribonucleotides. Each ribonucleotide unit is…

Q: Suppose an mRNA transcript with the following base sequence reaches a ribosome: 5'-…

A: A codon is a sequence of three consecutive nucleotides in a DNA or RNA that codes for a specific…

Q: CAUCGGAAUAGAUCGCUAGUGGCAGGCAUAAUGAUCACCGGUCUGAGAAAAGUGGUACAUAUCAAC-5

A: Genetic codes are read in the form of triplets.first we will convert them to the triplets and then…

Q: Most of the mutations that Yanofsky recovered were missense mutations. However, Yanofsky also…

A: Hypothesis is basically a proposed explanation for any naturally occurring phenomenon in the…

Q: What experimentally derived information led to Holley’s proposal of the two-dimensional cloverleaf…

A: Introduction:  The structure of tRNA was first elucidated by Holley for the amino acid alanine. Its…

Q: Describe translation. What is the function of the aminoacyl-tRNA synthase?

A: Protein synthesis: It is a process that involve peptide bond formation between the amino acids by…

Q: The protein Xpot transports tRNAs out of the nucleus so that they can be aminoacylated in the…

A: tRNA or transfer RNA is the RNA molecule that attaches to an amino acid as per the anticodon…

Q: Explain the significance of the following statement: The functioning of the aminoacyl-tRNA…

A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…

Q: The following segment of DNA in a hypothetical model organism encodes a polypeptide containing SEVEN…

A: Francis Crick proposed central dogma. The RNA is formed from DNA with the help of enzyme RNA…

Q: Describe the processing events that occur during the production of tRNA in E. coli.

A: Transfer ribonucleic acid or tRNA is a RNA molecule that decodes the mRNA into a protein . Each tRNA…

Q: Each tRNA has unique identity elements recognized by its specific enzyme involved in charging it…

A: Transfer RNA (abbreviated tRNA and formerly referred to as sRNA, for soluble RNA is an adaptor…

Q: Although Ribosome binding site sequence vary considerably in different genes, they include examples…

A: Ribosome binding site (RBS) includes a sequence of nucleotide, which are present upstream the…

Q: The tRNA having a cloverleaf structure suggests the following features EXCEPT

A: Answer - It is a single stranded linear structure with protein coding sequences.

Q: The free energy of binding of codon on mRNA and anticodon on tRNA is -9 kT. What is the probability…

A: In thermodynamics, free energy is the function of internal energy, entropy, and enthalpy. The…

Q: Explain why a 50S ribosomal subunit and a 30S ribosomal subunit combine to form a 70S subunit,…

A: Ribonucleoproteins form the basic unit of ribosomes and they are a complex of RNA and proteins. They…

Q: Suppose the following peptide chain was attached to a gly -tRNA during translation : met -leu-asp…

A: Serine will be added next to glycine in the growing peptide chain through formation of a peptide…

Q: True or false: A fully assembled 70S ribosome is recruited to the mRNA just 5 ́ of the translation…

A: The translation begins with the attachment of messenger ribonucleic acid (mRNA) with the ribosome.…

Q: In prokaryotic protein synthesis, Nformylmethionine (fmet) is the first amino acid incorporated,…

A: Introduction: The process of protein synthesis from mRNA is called translation. The process of…

Q: The BSA precursor protein is 607 amino acids long and has a molecular weight 69.324 kDa. If a…

A: BSA is globular proteins.  1kDa =  1.66 * 10-21 gm The molecular weight of BSA precursor protein is…

Q: ) Identify the current stage of the translation process shown in Figure 1 and name the anticodon…

A: Translation is a orocess in which mRNA produce  protein by the help of ribosome and tRNA.there are…

Q: As we focused on the genetic code and the transcription of genetic information stored in DNA into…

A: BASIC INFORMATION  GENETIC CODE  The genetic code term was coined by George Gamow. There are total…

Q: As we focused on the translation of mRNA into proteins as well as on protein structure and function.…

A: mRNA It is subtype of RNA. Am mRNA molecule carries a portion of the DNA code to other parts of the…

Q: Consider à ollowing sequence: His-Cys-Leu-lle-Met where Met is at the C-terminus end. Based on the…

A: Amino Acids are are structures linked by Peptide Bonds to Form Polypeptide Chains. Proteins are…

Q: The ribosome can transfer any peptidyl group from the P-site tRNA to any aminoacyl group on the…

A: Proteins or polypeptides are sequence of amino acids which are linked by peptide bond or amide bond.…

Q: Explain the interactions of specific tRNA with its synthetase, by including the importance of…

A: Answer) Cloverleaf structure of tRNA: It is formed due to the intramolecular hydrogen bonds and…

Q: Once the chains of peptides that make up lysyl-tRNA synthetase protein are synthesized in ribosomes,…

A: Protein folding is the process where the proteins fold themselves to come to their native form. This…

Q: What steps are required to form a charged tRNA?

A: Transcription: It is processed to convert DNA into RNA. It is part of the central dogma. It is…

Q: Renata enzymatically conjugates a l"C-labeled cysteine to a transfer RNA (TRNA), with a UGU…

A: Transcription involves the copying of information from a strand of DNA into a new molecule of…

Q: What would be the tRNA anticodons for the mRNA in question 3

A: Answer- ATGGATCT CGA- UACCUAGA GCT will be the following anti-codons .

Q: Can a tRNA exist that has the anticodonsequence 5′ IAA? If so, which amino acidwould it carry?

A: Transfer RNAs (tRNAs) are essential in protein synthesis and elongation. The sequence on the mRNA…

Q: tRNAs contain 4 arms, each characterized by the presence certain modified bases or speciic…

A: tRNA have 4 major arms and 1 variable arm. The 4 major arms of tRNA are ; D arm Anticodon arm  TψC…

Q: Identify and define the two essential structural areas of a tRNA molecule

A: Transfer RNAs are coded by a number of genes, and are usually short molecules, between…

Q: Label the following regions on this tRNA molecule, stating the function of each:

A: This is a tRNA molecule. It has an amino acid arm where the corresponding amino acids bind. It has…

Q: What features of tRNA structure are involved in recognition and amino acylation by an aaRS?

A: Transfer RNA also called amino acid acceptor RNA, adaptor RNA, or soluble RNA is the RNA that…

Q: in a clever experiment performed in 1962, a cysteine already attached to its tRNA was chemically…

A: The tiny RNA molecule transfer RNA (abbreviated tRNA) is essential for protein synthesis. Transfer…

Q: The a chain of eukaryotic hemoglobin is composed of 141 amino acids. What is the minimum number of…

A: There is an intimate connection between genes and synthesis of polypeptides or enzymes. Genes are…

Q: "The helix must undergo localized unwinding, and theresulting “open” configuration must be…

A: DNA is the genetic and hereditary material in all living cells (except a few viruses). DNA is passed…

Q: Why mRNA is much more variable in its 3-dimensional shape than is DNA? does there is implications of…

A: Introduction  DNA and RNA are the main genetic material found in all the species irrespective of…

Q: Describe the major structural features of tRNA.

A: Ribonucleic (RNA) nucleic acid, which is of three main types such as mRNA, rRNA, and tRNA and all…

Q: Which of the following is NOT a general feature of tRNA? A. All TRNAS contain 4 loops, the anticodon…

A: tRNA is transfer RNA which is an adaptor molecule and assists in formation of peptide chain during…

Q: As we focused on the genetic code and the transcription of genetic information stored in DNA into…

A: Introduction: Splicing is a process where non-coding sequences of an m-RNA is removed from the…

Q: Using the genetic code table, find the sequence of amino acids coded by the 2 DNA sequences (documi…

A: Transcription is the process by which the genetic information in the DNA segment is copied into an…

Genome annotation

The technique of linking biological information to genome sequences is termed genome annotation. Gene annotation is the method of identifying gene locations and coding sections. It helps us understand what these genes are doing in the body through establishing structural characteristics and linking them to the actions of various proteins.