Bacteria and other microbes can be used to "clean up" an oil spill by breaking down oil into carbon dioxide and water. Two amples isolated from the Deepwater Horizon leak in the Gulf of Mexico were labeled A and B. The DNA of each was isolated and the percent thymine measured in each sample. Sample A contains 19.3% thymine and sample B contains 27.9% thymine. Assume the organisms contain normal double-stranded DNA and predict the composition of the other bases. percent adenine in sample B: percent guanine in sample B: percent cytosine in sample B: Both samples are then denatured to remove the secondary structure. Which will have the higher temperature to denature? 88 %A %G %C

Bacteria and other microbes can be used to "clean up" an oil spill by breaking down oil into carbon dioxide and water. Two amples isolated from the Deepwater Horizon leak in the Gulf of Mexico were labeled A and B. The DNA of each was isolated and the percent thymine measured in each sample. Sample A contains 19.3% thymine and sample B contains 27.9% thymine. Assume the organisms contain normal double-stranded DNA and predict the composition of the other bases. percent adenine in sample B: percent guanine in sample B: percent cytosine in sample B: Both samples are then denatured to remove the secondary structure. Which will have the higher temperature to denature? 88 %A %G %C

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter8: The Structure, Replication, And Chromosomal Organization Of Dna

Section: Chapter Questions

Problem 17QP: Chemical analysis shows that a nucleic acid sample contains A, U, C, and G. Is this DNA or RNA? Why?

See similar textbooks

Similar questions

All of the following statements are correct EXCEPT a. DNA forms described by Watson and Crick have right handed helix except of Z-DNA form b. In case of Z-DNA form, the deoxyribose phosphate backbone forms a "Zigzag structure" c. Inverted DNA sequence repeat that happens within each individual strand of the DNA, called cruciform d. Plasmid carries genes that convey antibiotic resistance to the host bacterium
Write the sequence of a strand of DNA replicated using each of the following base sequences as a template: a. T C G A G A A T C T C G A T T b. C C G T A T A G C C G G T A C c. A T C G G A T C G C T A C T G
What is the role of alcohol in extracting DNA? DNA is a polar molecule with an overall negative charge, and as such is not soluble in alcohol, and therefore precipitates. DNA is a polar molecule with an overall positive charge, and as such is not soluble in alcohol, and therefore precipitates. DNA is a non polar molecule with an overall negative change, and as such is soluble in alcohol, and therefore precipitates. DNA is a polar molecule with an overall positive change, and as such is soluble in alcohol, and therefore precipitates.
Chemical analysis shows that a nucleic acid sample contains A, U, C, and G. Is this DNA or RNA? Why?
The last steps of DNA extraction include washing it using ethyl alcohol and drying the DNA pellet. Why do we need to wash the DNA using ice-cold ethyl alcohol? And why do we have to dry the DNA pellet?
Why is it important that the alcohol used in the DNA extraction is kept cold? The solubility of any compound is reduced at lower temperatures. The colder the temperature of the alcohol, the greater the yield of DNA due to increased precipitation of DNA at the interface between the aqueous and alcohol layers. The solubility of any compound is increased at lower temperatures. The colder the temperature of the alcohol, the greater the yield of DNA due to increased solubility of DNA at the interface between the aqueous and alcohol layers. The solubility of any compound is reduced at lower temperatures. The colder the temperature of the alcohol, the greater the yield of DNA due to increased precipitation of DNA in the aqueous layer. The solubility of any compound is increased at lower temperatures. The colder the temperature of the alcohol, the greater the yield of DNA due to increased solubility of DNA in the aqueous layer.
A linear piece of DNA was broken into random, overlapping fragments and each fragment was sequenced. The sequence of each fragment is shown below. Fragment 1: 5′–TAGTTAAAAC–3′ Fragment 2: 5′–ACCGCAATACCCTAGTTAAA–3′ Fragment 3: 5′–CCCTAGTTAAAAC–3′ Fragment 4: 5′–ACCGCAATACCCTAGTT–3′ Fragment 5: 5′–ACCGCAATACCCTAGTTAAA–3′ Fragment 6: 5′–ATTTACCGCAAT–3′ On the basis of overlap in sequence, create a contig sequence of the original piece of DNA.
This image shows DNA (gray) interacting with a computergenerated model of a TAL protein (multicolored), one of afamily of proteins found only in a species of the bacteriumXanthomonas. The bacterium uses proteins like this one to findspecific gene sequences in cells of the organisms it infects, suchas tomatoes, rice, and citrus fruits. Given what you know aboutDNA structure and considering the image above, discuss howthe TAL protein’s structure suggests that it functions
What is the base sequence, specified in the 5′-to-3′ direction, for a segment of newly formed DNA if it was formed using the following template DNA segments? 3′ AATGC 5′ 5′ AATGC 3′ 3′ GCAGC 5′ 5′ GCAGC 3′
In DNA isolation techniques, a washing step is always done prior to the final resuspension. What is the purpose of this step? In DNA isolation from blood samples, why does the vial for blood storage contain EDTA? In the preparation for DNA isolation in plants, the plant source is refrigerated and ground prior to extraction. Why is this so? Why are DNA pellets air-dried before resuspension in buffer?
Give an estimate of the fragment sizes (basepairs) of the DNA bands from each sample lane of the gel electropherogram below. lane 1: lane 2: lane 3:
consider the DNA segment with a sequence: 3'-TACGGTACGGGATTG-5'. if the given DNA sample was subjected to ion-torrent sequencing, sketch the expected profile of the sequencing output. assume that the sequential flooding of nucleotides follows the order G-C-A-T.