Q: You would expect antibiotics to effectively treat: O A. Chickenpox virus O B. The flu O C. Common…
A: Introduction Infection:- It is the invasion and growth of germs in the body, The four main types of…
Q: The switching of the components of the blood protein hemoglobin during embryonic and fetal…
A: Foetal haemoglobin is the oxygen carrier protein that transfers oxygen from mother's blood stream to…
Q: Biology Myosin motor proteins are NOT involved in which of the following? Regulating the mitotic…
A: Nonmuscle myosin II has role in cancer cell migration . Myosin act as a signalling molecule and…
Q: Topic:Excretion in animals Distinguish isotonic, hypotonic and hypertonic solution from one another…
A: Answer :: Isotonic solution :- Both the solutions, in and out of the cell have same water and…
Q: Skeletal muscle contraction requires: O calcium ions O ATP O arrival of a nerve impulse all the…
A: Skeletal muscle is composed of muscle fibres which have smaller units called myofibrils. There are…
Q: Biology ___________ is the period of time in which a cell divides. (Mark all that apply) Group of…
A: Introduction The cell is the most fundamental structural and functional unit of life. Every cell has…
Q: mutation would be least harr
A: (a) Silent mutations are when the mutations do not have any observable effect on the phenotype of an…
Q: Small molecules binding to histone proteins also control gene expression by chromatin remodelling…
A: Genes or DNA are generally coiled and held together by the help of structural proteins called…
Q: Use the measurement tool to measure the zone of inhibition for each antibiotic sample in millimeters…
A: Antibiotic zone of inhibition Antibiotics are the compounds or substances that kill or inhibit the…
Q: The dentist in your office asks you to be responsible for maintaining OSHA compliance in the office…
A: OSHA's fundamental reason is to make certain that personnel paintings in a secure and invigorating…
Q: What do you do in between each streak on a streak plate?
A: The streak method is used in the isolation of the pure colony of the organism from a mixed…
Q: What are the economically important members of the Musaceae family? Give its characteristics and…
A: Musaceae is a group of Flowering plants made out of three genera with around 91 known species,…
Q: . Why are there fewer top predators in ecosystems than herbivores? give an example.
A: In an ecosystem, the energy flow occurs from one tropic level to another tropic level similar to a…
Q: Label the parts of the frog
A: Introduction A frog is any member of the order Anura, which consists of a diverse and primarily…
Q: To identify: The three levels of biological diversity.
A: Biodiversity refers to the variety of plants and animals that live in a given ecosystem. The members…
Q: 12: E is not the correct answer, what is the correct answer Flatworm parenchyma cells that are stem…
A: Introduction:- Flatworms are acoelomate animals that include parenchyma cells, which are used to…
Q: The digestive tract and the gut microbiome have a mutualistic relationship. What does this mean? O…
A: Mutualism is a type of symbiotic relationship where all species involved benefit from their…
Q: 14. Non-native species: are nearly always the cause of habitat degradation. always lead to lower…
A: In the given question we are asked about the non-native species which are the species that do not…
Q: Biology ex. Locate any woodland or forest area close to your home. Create a 10 x 10 m quadrat once…
A: The goal of the study is to use techniques to achieve the goal. During the process, information…
Q: Biology ex. Locate any woodland or forest area close to your home. Create a 10 x 10 m quadrat once…
A: The goal of the research is to achieve the goal through the application of techniques. During the…
Q: The names of five (5) personal care or cosmetic brands that have nanotech ingredients. b. The…
A: Nanoparticles Nanoparticles are ultrafine molecules of diameters between 1 to 100nm. Being smaller…
Q: QUESTION 7 The below figure depicts the 'transcription tree' of RNA transcription. Use this figure…
A: Transcription is a process of synthesis of RNA from the template strand of DNA by the action of RNA…
Q: Bone tissue contains: O living cells O collagens fibers O calcium and phosphorus O all the above
A: Tissue is a group of cells which perform specific function. The tissue present in the bone is known…
Q: What do young herring gulls want when they peck the red spot on their parents' bills?
A: Pecking is a specialised behaviour in words suggesting that they need something. These birds are…
Q: TRUE or FALSE [For extra credit, correct False statements] a. Proteins that lack a sorting signal…
A: Signal sequence are the sorting signals that direct the protein to the secretory pathway in…
Q: You want to produce a biological agent to kill bacteria that cause disease. Which organism you will…
A: Antibiotics are drugs that help the host's defense mechanism combat infection by preventing…
Q: 2"
A: Star fish are echinoderms that undergoes sexual reproduction and embryo development take place…
Q: Elucidate the fundamental challenges the aquatic vertebrates and terrestrial vertebrates face in…
A: Aquatic Vertebrate is any newly hatched animal with a backbone or spinal column that spends the most…
Q: Which of the following diseases is caused by a pathogen that is NOT a living organism? O A. Guinea…
A: A pathogen is an infectious agent that causes a disease. In general, there are five main types of…
Q: Which of the following is NOT a part of the axial skeleton? scapula sacrum O ribs O cranial bones
A: The skeletal system is responsible for providing the framework to the body. It is made up of bones.
Q: Myosin motor proteins are NOT involved in which of the following? Regulating the mitotic organizing…
A: Myosins are motor protein as well as signalling molecules. A complete round of ATP hydrolysis…
Q: If predicted genotypic frequencies do not match actual genotypic frequencies, what is true of the…
A: A population in Hardy-Weinberg equilibrium for a gene is not changing, and allele frequencies remain…
Q: How would the graph of the number of individuals of a population that has experienced disruptive…
A: Introduction Natural selection is a process of evolution. In this process the species which can only…
Q: How do humans contribute to ocean acidification/decreasing ocean pH and what is the backfire of this…
A: Introduction :- The capture of carbon dioxide from the atmosphere causes ocean acidification, which…
Q: Heart muscle works hard and therefore consumes much ATP. Which organelles would you expect to be…
A: Heart muscle or cardiac muscle signifies the thick middle layer of heart, which is known as…
Q: Q-7. Receptor Mediated Endocytosis a. Which protein depicted is a small monomeric GPTase? b. Are all…
A: Receptor-mediated endocytosis (RME), also called clathrin-mediated endocytosis, is a process by…
Q: Short Answer. 1. Predict what would happen to a peppered moth population . The light lichens on the…
A: Prey and predator species In an ecosystem variety of organisms live together with these all share…
Q: The equation for photosynthesis is 6CO2 + 6H2O + Sunlight --> C6H12O6 + 6O2. Explain the role of…
A: Photosynthesis is a set of chemical reactions performed by plants to convert light energy from sun…
Q: Amari suspects they have a condition called metatarsalgia. This term is related to the term…
A: Introduction Metatarsalgia is a painful and inflammatory condition affecting the ball of your foot.…
Q: Epigenetic changes in chromatin remodelling which selectively PREVENTS transcription Acetylation…
A: DNA is the store house of genetic information. This genetic information is expressed as protein…
Q: Label the following diagram: C A G B.
A: Introduction Translation is the process by which ribosomes in the cytoplasm or endoplasmic reticulum…
Q: Which of the following changes would cause directional selection? a A habitat made of trees with…
A: Directional selection This selection takes place when organisms having characteristics represented…
Q: membranes line the cavities between bones in moveable joints. O Mucous O Serous Cutaneous O Synovial
A: It is important to know that a thin layer of cells cover the skin (outer layer of body),…
Q: effect of increasing nucleocytoplasmic ratio during cleavage formation?
A: Cleavage Cleavage is defined as the embryological cell division. The resulting cells after cleavage…
Q: Your friend is convinced his calico cat is male. He takes the cat to the vet. Sure enough the cat is…
A: Calico cats have tricolour coat. Their colouring is related to the X chromosome that's why they…
Q: C. Discuss the pathogenicity of Strongyloidiasis. How can a human acquire the infection?
A: Infections with Strongyloides stercoralis causes strongyloidiasis. Stomach pain and diarrhoea, rash,…
Q: Why is biodiversity important? Increased biodiversity can lead to improved and functioning…
A: Biodiversity orginates from words Bios=life forms ,diversity =different forms . Hence biodiversity…
Q: a.) The conversion of the genital ridge into the bipotential gonad requires the Sf1, Wt1, and Lhx9…
A: Sex determination : There are certain genes which plays important role in sex determination. But…
Q: What happens to the size of cells as the cell number increases? Do they get bigger or smaller in…
A: Cell Growth: Cell growth is defined as an increase in a cell's total mass, which includes the volume…
Q: Nutrient pollution leads to __________ in many coastal waters and can cause dead zones. excess…
A: Introduction The amount of dissolved oxygen required by aerobic biological organisms to break down…
Gene Interactions
When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.
Gene Expression
Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.
Step by step
Solved in 2 steps
- Choose the DNA sequence from which this mRNA sequence wastranscribed: 5′-AUACGAUUA-3′.a. 3′-TATGCTAAT-5′ c. 3′-UAUCGUAAU-5′b. 3′-UTUGCUTTU-5′ d. 3′-CTCAGCTTC-5′Write a mRNA sequence for the below nucleotide sequences ATTACACACAGCGCGTATACGCGCGCGGGCTATAWhich is the mRNA molecule that would be transcribed from this DNA template: TGGCAAGTACGT answer choices A.) ACCGUUCAUGCA B.) UCCGUUCUUGCU C.) ACCGTTCATGCA D.) UGGCAAGUACGU
- Use the Genetic Code below to help you answer the following questions. The nucleotide sequence of a hypothetical eukaryotic gene is: 3'- CCC CAT CAG TCA AGG GAA - 5' a. Provide the mRNA of the non-mutated gene. b. Provide the linear amino acid sequence of the non-mutated gene. üü c. Examine the mutated DNA sequence below. What would be the sequence of the mRNA? ü Mutated DNA sequence: 3' CCC CAC AGT CAA GGG AA 5' d. Provide the linear amino acid sequence of the mutated gene and identify the type of mutation. e. Comment on the consequences of this type of mutation?Complete the box below: Convert the following template strand of DNA bases into its complementary mRNA molecule. Next translate the DNA into a polypeptide chain of amino acids using the Table above. CAATATGGAAGCCGACTCACCCTAATTGiven below is the mRNA sequence that encodes the amino acids of a protein. Based on the mRNA sequence predict the amino acid sequence that it encodes. Please list the protein sequence as SINGLE letter amino acids.mRNA: -AUGACACCACUCCACUUAUAGCCCUAA-
- Write a sentence describing the role of each of the following types of RNA in gene expression. mRNA- rRNA- tRNA- snRNA-Use the table to answer: A portion of an mRNA attached to a ribosome reads: 5′ GACCAUUUUGACAAAGUUGUAGUGUGGGUAGGGUGA 3′ If a tRNA with a Phe attached is in the P site of the ribosome, an uncharged tRNA will be present in the E site that delivered which amino acid? What is the last amino acid in this polypeptide? Which amino acid will be the most frequent in the polypeptide?In the table circle each codon in the sequence of nucleotides in the mrna molecule. Indicate the amino acids that would appear in protein produced by translations of this mRNA sequences.
- Refer to the figure to answer these questions:a. Add labels for mRNA (including the 5′ and 3′ ends) and tRNA. Inaddition, draw in the RNA polymerase enzyme and the ribosomes,including arrows indicating the direction of movement for each.b. What are the next three amino acids to be added to polypeptide b?c. Fill in the nucleotides in the mRNA complementary to thetemplate DNA strand.d. What is the sequence of the DNA complementary to the templatestrand (as much as can be determined from the figure)?e. Does this figure show the entire polypeptide that this geneencodes? How can you tell?f. What might happen to polypeptide b after its release from theribosome?g. Does this figure depict a prokaryotic or a eukaryotic cell? How canyou tell?Complete the table below: DNA DNA Complimentary Strand mRNA sequence tRNA sequence Amino acid code A T G A A A G T C A T T T A GUse your genetic code (codon) table to answer the next two questions: What type of mutation would result if the sequence of a gene were altered so that the sequence of the mRNA was changed from: AUGCCGUGCAGUAAC to AUGCCAUGCAGUAAC A) a silent mutation B) a nonsense mutation C) a frame-shift mutation D) a missense mutation E) a base insertion mutation