Complete this table for the reaction T(k) [N2] [H2] [NH3] [Kc] 500 0.115 0.105 0.439   575 0.110   0.128 9.6 At which temperature is the product favored the most?

Q: Identify the peaks and structer.

A: 13C-NMR shows an non-equivalets of the carbons in the spectrum. The number of signals in the spctrum...

Q: hybridization

A:

Q: How many grams of Cr are there in a sample of Cr that contains 6.84×1023 atoms? grams

A: The amount of chromium present can be calculated as

Q: (G) (F) |(H) da. HSO, (C) HNO, (A) (1) FCI, (B) (D) (E) 1. KMOOR (J) 2. HCT

A: Ans -   A)  Substitution Reaction in five memered                         cyclic ring on benzene B) ...

Q: Write the balanced NET IONIC equation for the reaction that occurs when hydroiodic acid and potassiu...

A:

Q: BUFFERS CH3COOH and CH3COONa NH,OH and NH&Cl H3PO4 and NaH2PO4 H2CO3 and NaHCO3 NH3 and (NH4)2CO3

A: Buffers are the solutions which resist the pH change.  Acidic buffer is the mixture of weak Acid/bas...

Q: GENERAL CHEMISTRY 2 (STEM GRADE 12) Name: Section: Score: Code # I. Modified True or False Direction...

A: Solution is made up of solute and solvent. Solute is present in small amount and solvent is present ...

Q: How can we make solids dissolve faster? Exercise 3.6 Ex In this exercise, you will think about the f...

A:   1.Which factor that affects dissolving is being tested? Answer :   continuous stirring cause more ...

Q: 3. Molality How many grams of solute is present in 2.5 moles Magnesium hydroxide, Mg(OH)2 in 669 g w...

A: Molar concentration of a solution can be defined as the number of moles of solute dissolved per litr...

Q: Read carefully the given partial names in IUPAC alkane nomenclature and check the columns where they...

A:

Q: Draw the structure of the following compounds. Use line-angle structural formula. 1-bromo-4-ethyl-5-...

A:

Q: Rubbing alcohol is a commonly used disinfectant and has a cooling effect when applied to the skin. T...

A: Given, Common concentration of rubbing alcohol = 70 % (v/v) Concentration of isopropanol solution us...

Q: Example 8 Calculate the corrosion rate in mpy of Al specimen (5 cm²) immersion in aqueou 2 days, giv...

A: Area = 5cm2  

Q: the ED50 of a recreational drug be defined as the amount required for 50% of a test group to feel hi...

A: ED50 of a recreational drug be defined as the amount required for 50% of a test group to feel high o...

Q: A student carried out an experiment and used 20.00 mL of 0.0100 M NaOH to titrate the excess HCl in ...

A: We are given an amount of NaOH being used to titrate the acid in an antacid reaction. We have to fin...

Q: C3H8(g) + 502(g) = 3CO2(g) + 4H2O(g)

A:

Q: How many moles of Mg are there in a sample of Mg that contains 1.36x1024 atoms? moles

A: Given Atoms of Mg = 1.36 x 1024 atoms

Q: Problem 48 C10H200 Problem 48 - 13C NMR spectrum (CDC13, 125 MHz) MW = 156 34.5 45.0 22.2 23.1 20.1 ...

A: 13C-NMR: 13C-NMR provides information about the types of carbons of unknown. The peaks in the range ...

Q: In a gravimetric analysis, we need enough product to weigh accurately. Each tablet provides ~15mg of...

A:

Q: Aluminum reacts with chlorine gas to form aluminum chloride via the following reaction: 2Al(s) + 3C1...

A:

Q: Why does  acid rain fall far from the source?  Show the equations  leading  from  the combustion  of...

A: Interpretation- Tell why does acid rain fall far from the source and show the equation leading from ...

Q: Under certain conditions the rate of this reaction is zero order in dinitrogen monoxide with a rate ...

A:

Q: 1. An oligonucleotide (a short DNA or RNA) has the following sequence: ACGTGGTTCCATGGTACGGC (a) Show...

A:

Q: Some measurements of the initial rate of a certain reaction are given in the table below. [H] [4] in...

A: Given, [ H2] [ I2] Initial rate M/s 1.00 M 0.881 M 0.392 1.00 M 0.0933 M 0.0415 1.50 M 0.88...

Q: How does the following affect the acidity or basicity of compounds? Explain clearly and thoroughly. ...

A: Answer is :

Q: Copper (II) sulfate pentahydrate, CuSO4 • 5 H2O, has 5 moles of H2O for each mole of CuSO4 in the so...

A:

Q: Determine the molar mass of an unknown nonvolatile solute of nonelectrolyte compound raising the boi...

A:

Q: Draw (be specific on the structures of each component in the cycle) and explain the entire process o...

A:

Q: 1.08 g H2 is allowed to react with 9.83 g N2, producing 1.36 g NH3. Part A What is the theoretical y...

A:

Q: A student calculated that the average neutralizing power of their antacid was 102 grams of acid neut...

A:

Q: Complete the table below for calculating the molar mass of the ionic compound cobalt(II) iodide . Fo...

A: The mass of one mole of a compound is known as the molar mass of the compound. The molar mass of an ...

Q: 15. Provide a curved arrow mechanism for the transformation below. OCH, Br2 + enantiomer Br CH,OH 16...

A: The correct answer is given below

Q: Draw the expanded structural formula of an organic compound with sixteen carbons using the following...

A: We have to draw the structure according to rules given above.

Q: What is observed when the Na2SO3 solution is added to the CuCl2 solution?

A: Given question is :  What is observed when the Na2SO3 solution is added to the CuCl2 solution = ?

Q: Which of the following strategies is NOT used in the regulation of glycogen phosphorylase? O phospho...

A: Glycogen is stored at liver,muscle. Phosphorylation converts inactive form to active form. Regulatio...

Q: Problem 64 - IR spectrum Problem 64 C10H120 50- MW = 148 40- 30- 20- 10- 3500 3000 2500 2000 1500 10...

A:

Q: Why are these two structures enantiomers? They look more like structural isomers to me.

A:

Q: How many grams of Xe are there in a sample of Xe that contains 8.97×1023 atoms?

A: First we have to determine the moles of xenon.

Q: How many mL of 15.8 M nitric acid should be diluted to 0.250 L to make 3.00 M HNO3?

A: Given  Initial Molarity of HNO3  ( M1 ) = 15.8 M  Final Volume ( V2 )   =  0.250 Liter              ...

Q: Describe the preparation of the following reagents. 3. 375 mL of 40 ppt Cl" from 0.01 M P6CI2

A: Solution -

Q: 00. Would this be a goo f HOAC at pH 4.757, hov

A: Given as, pKa 1=2.19,pKa 2=6.94,pKa 3=11.51.   As per rule, allowed to answer one question and post ...

Q: Calculate the pH of a solution formed by mixing 120.0 mL of 0.30 M HClO with 1180.0 mL of 0.20 M LiC...

A:

Q: Complete the table below for calculating the molar mass of the ionic compound chromium(II) sulfide. ...

A: Given, Chromium (II) sulfide.

Q: Calculate the mass in kilograms of 11.9 mol of CuF2 2H20. kg CuF2 2H20

A:

Q: Determine the point group of the following molecule: C Mo: C O -C=O O=C. O=C C

A:

Q: TASK 2: Answer ME! Directions: Read and understand the following questions and write the letter of t...

A: Dear student since it is a multiple subparts questions according to guidelines here I am solving onl...

Q: 6. Complex Polymer Growth a. Propose a synthesis of the following compound using a commercial carbox...

A:

Q: 1. In a combustion process of a coal-fired power plant, 20% excess of the theoretical amount of Oxyg...

A: Answer is below

Q: F. `N' `N' HN, Amoxicillin NH2 H H CH3 CH3 HO CO2H Identify the functional groups present in each dr...

A:

Q: Balance the following chemical equation (if necessary) for the combustion reaction of propane: C3H8(...

A: In multiple questions we solve only first question according to Bartleby guidelines. Balance the ele...

Group 15 elements

The elements of group 15 are phosphorus, nitrogen, bismuth antimony, and arsenic. The most abundant element which is present in the air is nitrogen and the percentage of nitrogen present in the air is 78%. In the free state, the elemental nitrogen is present as diatomic gas (N2). In the organic matter obtained from plants and animals, phosphorus is the dominant element present. In nucleic acids, phosphate groups are present. Phosphates are also found in teeth and bones. The other elements arsenic, bismuth, and antimony are found as sulfides. Arsenopyrite, bismuth glance, and stibnite are examples of sulfides of arsenic, bismuth, and antimony respectively.