Consider the following simple regulatory pathways. Assume the full pathway is shown. 1 A 2 B B – 3 C E 4 Ꭰ - F G I H J || L You identify several null mutations (a complete deletion of the gene). For each mutant (indicated with a - sign), determine whether the final product (I, J, K or L) is inducible, uninducible, or constitutive. K

Consider the following simple regulatory pathways. Assume the full pathway is shown. 1 A 2 B B – 3 C E 4 Ꭰ - F G I H J || L You identify several null mutations (a complete deletion of the gene). For each mutant (indicated with a - sign), determine whether the final product (I, J, K or L) is inducible, uninducible, or constitutive. K

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter10: From Proteins To Phenotypes

Section: Chapter Questions

Problem 9QP: a. Compounds A, B, C, and D are known to be intermediates in the pathway for production of protein...

See similar textbooks

Similar questions

If the following nucleotide sequence represents the active domain of the COVID19’s M-protein 5’ ---- 5’ GGGUACAUGGUAGCCCCCGUCGAGAAAACACCC …. 3’ a) describe a potential mutation that may occur and the mechanism that could fix it b) if the repair mechanism is faulty, explain the consequences for COVID19 & that of the infected individual
Based on the following wild type sequence, indicate if each of the mutations should be classified as : insertion, deletion, missense, nonsense, silent (Use the provided Genetic Code table). Wild Type: GUC GCC GAC GAG AGG Mutant 1: GUC GCC AGA CGA GAG G Mutant 2: GUC GCC ACG AGA GG Mutant 3: GUC GCC AAC GAG AGG Mutant 4: GUA GCC GAC GAG AGG Mutant 5: GUC GCC GAC UAG AGG
A strain of bacteria possesses a temperature-sensitive mutation in the gene that encodes the rho subunit. At high temperatures, rho is not functional. When these bacteria are raised at elevated temperatures, which of the following effects would you expect to see? Explain your reasoning for accepting or rejecting each of these five options. a. Transcription does not take place. b. All RNA molecules are shorter than normal. c. All RNA molecules are longer than normal. d. Some RNA molecules are longer than normal. e. RNA is copied from both DNA strands.
In a line of human cells grown in culture, a geneticist isolates a temperature-sensitive mutation at a locus that encodes an acetyltransferase enzyme; at temperatures above 38°C, the mutant cells produce a nonfunctional form of the enzyme. What would be the most likely effect of this mutation if the cells were grown at 40°C?
An individual carries a somatic mutation that changes a lysinecodon into a glutamic acid codon. Prior to acquiring this mutation,the individual had been exposed to UV light, proflavin, and5-bromouracil. Which of these three agents would be the mostlikely to have caused this somatic mutation? Explain your answer.
Which of the following correctly describes the regulation and activity of HIF-1? Group of answer choices VHL is required for preventing degradation of HIF-1alpha and promoting translocation to the nucleus In normoxia, HIF-1alpha is ubquitinated and degraded in the proteasome Hypoxic conditions result in increase hydroxylation of prolines in HIF-1alpha The primary function of HIF-1 is to phosphorylate and activate glycolytic enzymes
For each of the following situations, provide a plausible explanation for how it could lead to unrestricted cell division.(a) Colon cancer cells often contain mutations in the gene encoding the prostaglandin E2 receptor. PGE2 is a growth factor required for the division of cells in the gastrointestinal tract.(b) Kaposi sarcoma, a common tumor in people with untreated AIDS, is caused by a virus carrying a gene for a protein similar to the chemokine receptors CXCR1 and CXCR2. Chemokines are cell-specific growth factors.(c) Adenovirus, a tumor virus, carries a gene for the protein E1A, which binds to the retinoblastoma protein, pRb. (d) An important feature of many oncogenes and tumor suppressor genes is their celltype specificity. For example, mutations in the PGE2 receptor are not typically found in lung tumors. Explain this observation. (Note that PGE2 acts through a GPCR in the plasma membrane.)
The intermediates A, B, C, D, E, and F all occur in the same biochemical pathway G is the product of the pathway, and mutations 1 through 7 are all G –, meaning that they cannot produce substance G. The following table shows which intermediates will promote growth in each of the mutants. Arrange the intermediates in order of their occurrence in the pathway at which each mutant strain is blocked. A “+” in the table indicates that the strain will grow if given that substance, an “o” means lack of growth.
b. Compounds A, B, C, and D are known to be intermediates in the pathway for production of protein E. To determine where the block in protein-E production occurred in each individual, the various intermediates were given to each individuals cel Is in culture. After a few weeks of growth with the intermediate, the cells were assayed for the production of protein E. The results for each individuals cells are given in the following table. A plus sign means that protein E was produced after the cells were given the intermediate listed at the top of the column. A minus sign means that the cells still could not produce protein E even after being exposed to the intermediate at the top of the column. Denote the point in the pathway in which each individual is blocked.
a. Compounds A, B, C, and D are known to be intermediates in the pathway for production of protein E. To determine where the block in protein-E production occurred in each individual, the various intermediates were given to each individuals cel Is in culture. After a few weeks of growth with the intermediate, the cells were assayed for the production of protein E. The results for each individuals cells are given in the following table. A plus sign means that protein E was produced after the cells were given the intermediate listed at the top of the column. A minus sign means that the cells still could not produce protein E even after being exposed to the intermediate at the top of the column. Draw the pathway leading to the production of protein E.
The following is a portion of a protein: met-trp-tyr-arg-gly-pro-thr-Various mutant forms of this protein have been recovered. Using the normal and mutant sequences, determine the DNA and mRNA sequences that code for this portion of the protein, and explain each of the mutations. a. met-trp- b. met-cys-ile-val-val-leu-gln- c. met-trp-tyr-arg-ser-pro-thr- d. met-trp-tyr-arg-gly-ala-val-ile-ser-pro-thr-
Given the following genotypes, explain, by answering the questions in each number, how the mutation (identified by a (-) superscript) will affect E. coli grown in lactose medium. Will there be a complete set ofgene products? (Yes/No) Will the lac operon be turnedon/off? Will the cell survive? (Yes/No) a. i + p + o + z - y + b. i + p - o + z + y + c. i + p + o - z + y +