Please tell me the right answer for the questions A function of transfer RNA (TRNA) is to:copy DNA and carry the information to the ribosomecarry amino acids to the growing polypeptide chainstay in the nucleus and be copied by DNAread the codons and provide the site for protein synthesisExamine the diagram below.the base in Box 1 is adenine, what is the base in Box 2?Воx 2Воx 1 If a protein was made up of 12 amino acids, how many nucleotides would make up the DNA message (assume there are no introns)?122436What two types of molecules are involved when a codon pairs with its anticodon?MRNA & TRNAO DNA & MRNAFRNA & TRNADNA & TRNANA ENG17

By central dogma of molecular biology, the DNA (deoxyribonucleic acid) is first replicated to form…

A function of transfer RNA (TRNA) is to: copy DNA and carry the information to the ribosome carry amino acids to the growing polypeptide chain stay in the nucleus and be copied by DNA read the codons and provide the site for protein synthesis Examine the diagram below. If the base in Box 1 is adenine, what is the base in Box 27 Воx 2 Box 1

A function of transfer RNA (TRNA) is to: copy DNA and carry the information to the ribosome carry amino acids to the growing polypeptide chain stay in the nucleus and be copied by DNA read the codons and provide the site for protein synthesis Examine the diagram below. If the base in Box 1 is adenine, what is the base in Box 27 Воx 2 Box 1

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter16: Gene Expression

Section: Chapter Questions

Problem 20RQ: A scientist mutates elF-2 to eliminate its GTP hydrolysis capability. How would this mutated form of...

See similar textbooks

Similar questions

How many letters of an RNA molecule, in sequence, does it take to provide the code for a single amino acid? 1 2 3 4
An adult with a history of tanning has his genome sequenced. The beginning of a protein-coding region of his DNA reads ATGGGGATATGGCAT. If the protein-coding region of a healthy adult reads ATGGGGATATGAGCAT, identify the site and type of mutation.
A scientist mutates elF-2 to eliminate its GTP hydrolysis capability. How would this mutated form of elF-2 alter translation? Initiation factors would not be able to bind to mRNA The large ribosomal subunit would not be able to interact with itiRNA transcripts tRNAi-Met would not scan mRNA transcripts for the start codon elF-2 would not be able to interact with the small ribosomal subunit.
A scientist sequencing itiRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the sequence of the amino acid chain this itiRNA makes when it is translated?
Is an entire chromosome made into an mRNA during transcription?
If the genetic code uses triplets, how many different amino acids can be coded by a repeating RNA polymer composed of UA and UC (UAUCUAUCUAUC ...)? a. one b. two c. three d. four e. five
A scientist introduces a mutation that makes the 60S ribosomal subunit nonfunctional in a human cell line. What would be the predicted effect on translation? Translation stalls after the initiation AUG codon is identified The ribosome cannot catalyze the formation of peptide bonds between the tRNAs in the A and P sites The ribosome cannot interact with mRNAs tRNAs cannot exit the E site of the ribosome.
37. A portion of an mRNA attached to a ribosome reads: 5′ UUUGACCCCACG 3′ If a tRNA with an aspartic acid amino acid attached is in the P site of the ribosome, a tRNA with which amino acid attached will enter the A site? What amino acid will be attached to the amino group of the histidine encoded by this mRNA?
What is the nucleotide order in the complementary mRNA that can be transcribed from the given DNA strand? 3’-CATCGGAATAGATCGCTAGTGGCAGGCATAATGATCACCGGTCTGAGAAAAGTGGTACATATCAAC-5’
What is the last codon in this mRNA sequence? AUGCCAUGG
30. How can one identify the presence of introns in a hybrid of DNA and mRNA? Give an example of non-coding RNA and a regulatory DNA element.
UAA is a stop codon. Why does the UAA sequence in the segment of mRNA 5′-G-C-A-U-G-G-A-C-C-C-C-G-U-U-A-U-U-A-A-A-C-A-C-3′not cause protein synthesis to stop?