describe the process of translation/protein synthesis at the ribosome based on these figures FF-PPeptidylRNAAminoacyl-IRNAEF-Tu. GITPEF-TsProcess> continuesGTPAminoacylRNA.EF-Tu GTPEF-TuX EF-IsGDPPeptidyl-RNABinding(EF-Tu). GDPEF-TsTranslocationUẠC + GDP5'EF-GСТРEFPEFG. GTP5'Peptidyl transferPeptidyl-tRNAUnchargedIRNAformyt-Mt Aformiyt-NMetformyt-MMet 30SUACF-3 subunit(IF-1Shine-DalgarnosequenceAUG3'GTPIF-2 • fimet-tRNAfmet5'AUGUACIF-1)3'(IF-3)30S initiation complexIF-2GTP50SsubunitIF-2GDP + P+IF-D+ (F-35'AUGUẬC3'Asite70S initiationcomplexformyl-NMetinN-formykformyl-N

Name: describe the process of translation/protein synthesis at the ribosome
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: describe the process of translation/protein synthesis at the ribosome based on these figures FF-PPeptidylRNAAminoacyl-IRNAEF-Tu. GITPEF-TsProcess> continuesGTPAminoacylRNA.EF-Tu GTPEF-TuX EF-IsGDPPeptidyl-RNABinding(EF-Tu). GDPEF-TsTranslocationUẠC +

Answer: TRANSLATION = It is the process in central dogma where mRNA is translated in to proteins in…

Answered: describe the process of…

Science

Biology

describe the process of translation/protein synthesis at the ribosome based on these figures

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter29: Transcription And The Regulation Of Gene Expression

Section: Chapter Questions

Problem 15P

See similar textbooks

Similar questions

From this overall anticodon sequence in tRNA, 3'-CAUCGGAAUAGAUCGCUAGUGGCAGGCAUAAUGAUCACCGGUCUGAGAAAAGUGGUACAUAUCAAC-5' Using ONE-letter amino acid code starting from N-terminus to C-terminus, what is the amino acid sequence that will be coded for?
From this overall anticodon sequence in tRNA, 3'-CAUCGGAAUAGAUCGCUAGUGGCAGGCAUAAUGAUCACCGGUCUGAGAAAAGUGGUACAUAUCAAC-5' What is the amino acid sequence that will be coded for using ONE-letter amino acid code starting from N-terminus to C-terminus and using THREE-letter amino acid code starting from N-terminus to C-terminus
3a) In a hypothetical cell where "wobble" pairing was not allowed (i.e. every codon must be matched by a tRNA anticodon that is its perfect complement), how many tRNAs would be required to service all of the threonine codons?
15. Cellular proteins are oftentimes post-translationally modified. Choose one of the following PTMs: N-linked glycosylation, phosphorylation, ubiquitination, or GPI-anchor. Clearly indicate your choice, then address the following: (a) How is the PTM attached to the protein of interest? At which amino acid residue(s)? What enzyme(s) is involved, if any? (b) Is the PTM relatively stable or highly dynamic? Explain. How does the PTM become detached from the protein of interest? What enzyme(s) is involved, if any? (c) What is the function of the PTM? Provide one specific example.
Sequence: CCACCTGTACCCGGACACACCCTGGTGTCC Provide the FULL protein sequence encoded by the gene. Are different splice variants known for this gene?
From this overall anticodon sequence in tRNA, 3'-CAUCGGAAUAGAUCGCUAGUGGCAGGCAUAAUGAUCACCGGUCUGAGAAAAGUGGUACAUAUCAAC-5' What is the amino acid sequence that will be coded for using THREE-letter amino acid code starting from N-terminus to C-terminus.
GTTTTCACTGGCGAGCGTCATCTTCCTACT 1. Identify the gene from which the query sequence originates (Name of the gene)2. Provide the FULL protein sequence encoded by the gene.3. Are different splice variants known for this gene?4. What human disease has been connected to this gene?5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where theprotein carries no net electrical charge) of the protein.6. Provide the reference (in proper reference form: Author; Year; Title; JournalName; Volume; Page Numbers) for a recent publication involving the identifiedgene. This reference should NOT be a web page reference.7. Are there homologs for the identified gene in other systems? Identify one homolog in an invertebrate system (if there is none, provide a vertebratehomolog).8. What is the function (e.g. transcriptional regulation, transmembrane signaling,kinase, protease, etc.) of the protein(s) encoded by the gene.9. Generate a FULL protein sequence alignment for one of the…
This is Fos-Jun dimer (1FOS). Is the leucine zipper at the C-terminus or at the N-terminus of the helices? Are the helices parallel or antiparallel?
1CFD CALCIUM-FREE CALMODULIN How long is the protein’s primary sequence?Does this protein have any secondary, tertiary and/or quaternary structures present?Are there any molecular additions to this protein that are not amino ac
Sequence: CCACCTGTACCCGGACACACCCTGGTGTCC 1. Identify the gene from which the querysequence originates (Name of gene) 2. Provide the FULLprotein sequence encoded by the gene. 3. Are different splice variants known for this gene? 4. What human disease has been connected to this gene? 5. Calculate molecular weight (kiloDalton, kD) and calculated pI (the pH where the protein carries no net electrical charge) of the protein.
If the following nucleotide sequence represents the active domain of the COVID19’s M-protein 5’ ---- 5’ GGGUACAUGGUAGCCCCCGUCGAGAAAACACCC …. 3’ a) describe a potential mutation that may occur and the mechanism that could fix it b) if the repair mechanism is faulty, explain the consequences for COVID19 & that of the infected individual
peptide bond formation is catalizyed at the larger ribosomal subunit. does this happend in termination, since its right after elongation?