DesignalibriYLayout12.5OI Uabe X₂ X² A-ay-AFontmRNA:Unique UnigriffinDNA:traits:▼wwwwDNA:to searchmRNA:References13A A Aa-A5-5-5-mRNA:amino acids:traits:DNA:#>amino acids:traits:How DNA Determines Traits- Transcription and Translation Fill in easier type.pptx part 2 - WordMailings Review View ACROBATTell me what you want to do...A¶| CAG TCG TTT | ATG GGG CTT CTT TIT | GAG AAT TCA CGC |wwwww| CGA CAA CAC | GTA GTA | CAA AAA ATG | TTA TAG AAT GAC GGG TGG |wwww14| TTA TTG TTA CGG | AAA AGA CCT | GCA GCC TTG TGT |O$Paragraph=-12-1815%AaBbCcDc AaBbCcl AaBbCcL AaBbCcDc AaBb CcDc¶ Normal T Body Text 1 List Para... 1 No Spac... 1 Table Par...Styles16W187CfgOMf10num lk(p))捆AaBbCc[ Aa Bb1 Heading 1 1 Head1000000000J036°F

Introduction: Messenger RNA (mRNA) is a molecule that plays an important function in gene…

Design Layout References Mailings Review View ACROBAT 12.5 A A Aa-EEEE alibri - IU-abe X₂ x² A-ay- A- ▾ Font Unique Unigriffin DNA: mRNA: to search traits: DNA: mRNA: amino acids: traits: DNA: mRNA: amino acids: traits: How DNA Determines Traits- Transcription and Translation Fill in easier type.pptx part 2 - Word Tell me what you want to do... | CAG TCG TTT | ATG GGG CTT CTT TTT | GAG AAT TCA CGC | O Paragraph DI 180- | CGA CAA CAC | GTA GTA | CAA AAA ATG | TTA TAG AAT GAC GGG TGG | | TTA TTG TTA CGG | AAA AGA CCT | GCA GCC TTG TGT | 발 AaBbCcDc AaBbCcl AaBbCcL AaBbCcDc AaBbCcDc AaBbCc[ AaBE 1 Normal 1 Body Text 1 List Para... 1 No Spac... 1 Table Par... 1 Heading 1 1 Heac W S Styles OM O 目 36°F

Design Layout References Mailings Review View ACROBAT 12.5 A A Aa-EEEE alibri - IU-abe X₂ x² A-ay- A- ▾ Font Unique Unigriffin DNA: mRNA: to search traits: DNA: mRNA: amino acids: traits: DNA: mRNA: amino acids: traits: How DNA Determines Traits- Transcription and Translation Fill in easier type.pptx part 2 - Word Tell me what you want to do... | CAG TCG TTT | ATG GGG CTT CTT TTT | GAG AAT TCA CGC | O Paragraph DI 180- | CGA CAA CAC | GTA GTA | CAA AAA ATG | TTA TAG AAT GAC GGG TGG | | TTA TTG TTA CGG | AAA AGA CCT | GCA GCC TTG TGT | 발 AaBbCcDc AaBbCcl AaBbCcL AaBbCcDc AaBbCcDc AaBbCc[ AaBE 1 Normal 1 Body Text 1 List Para... 1 No Spac... 1 Table Par... 1 Heading 1 1 Heac W S Styles OM O 目 36°F

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter30: Protein Synthesis

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

5’ATCGCGCTAGGCGCATGCTACCTAGGCTATCTGCCTAGCTATCGACTAATCTGATCGAGTCAG3’ 3’TAGCGCGATCCGCGTACGATGGATCCGATAGACGGATCGATAGCTGATTAGACTAGCTCAGTC5’ Write out the pre-mRNA for this geneWrite out the mRNA for this geneHow many amino acids does this protein have? Translate the protein Label your 5’ and 3’ UTR’s
Humans have ~20,000 genes which create > 100,000proteins used by our cells. What process enables thisevolutionary success story?A. Coupling of transcription and translation to producemature mRNAsB. Addition of the 5' cap and 3' poly-A tail to produce maturemRNAsC. Alternative expression of introns to produce maturemRNAsD. Alternative splicing of pre-mRNAs to produce maturemRNAs
97Which of the following is examples of a transposable element found in bacteria? (multiple choice questions)A.IS903b.Tn5c.IS1D.Xis 98What is the key component of the catalytic site of the spliceosome? (multiple choice questions)A.DNAb.ribosomesc.proteinD.RNA 99Which antibiotic can binds to RNA polymerase and blocks an early step in RNA synthesis?A.Ampicillinb.Chloramphenicolc.RimantidineD.None of the above 100All tRNA molecules have poly (A) tails at their 3' end. Yesorno
Refer to the DNA sequence provided: 3’ -TACTGAAGCGGCAGCCCCGCATGAGTAGACCTTACT-5’ a. What is the mRNA transcript of the anticoding strand of the DNA model? b. What is the amino acid sequence of the polypeptide chain that will be translated from the mRNA in (a)?
70Pre-initiation begins with either TFIIF or TATA binding protein binding to the core promoter. Yesorno 71Exons tend to be non-conserved during evolution, whereas introns usually are conserved. Yesorno 72Transfer RNA molecules fold into L-shaped three-dimensional structures. Yesorno
What is the actual biological purpose of the CRISPR/Cas9 system? 9.2. Explain the fundamental difference between CRISPR/Cas9 and in vivo adenovirus-based gene therapy Explain why there is a part of the LacZ gene in pET32a(+) and also how the natural biochemical process wherein it normally functions is used during cloning by molecular biology.
1.Your goal is to design a strategy to create thisfinal pDHFR plasmid for fusion protein expressionfrom the materials available:You have an empty pET21a expression vector and another vectorthat contains the fusion protein nucleotide sequence (pBluescript + GST-DHFR-His). (#) indicatesbp location ofenzyme cut: a.EcoRIonly, HindIII only, NotIonly, EcoRI and HindIII, EcoRI and NotI, or HindIII and NotI? b.Briefly explain the rationale for your selection. Please connect your rationale to the need for compatible ends without any further manipulation and required directionality of the DHFR fusion protein coding sequence relative to the T7 promoter that will drive its expression. c.What is the final size(kb)of your desired pDHFR plasmid ligation product based onyour design? d. Complete the chart providedto indicate thesize of all fragments(in bp)resultingfrom complete digestion of each plasmid givenyour strategy, andthe fragment(in kb)from each you would isolate for ligation.Please mind…
Please select appropriate word in each bracket CRISPR-Cas9 is a system for directly changing the sequence of [ Select ] ["DNA", "RNA"] and is derived from bacterial systems designed to block infection by [ Select ] ["bacteriophage", "HIV"] . The original system contained two RNA molecules, crRNA and tracrRNA, that formed a complex that recruited Cas9 protein. Dr. Doudna and her colleague Dr. Emmanuelle Charpentier found they could make a single guide RNA (sgRNA) that had an [ Select ] ["intramolecular interaction (H-bonding)", "RNAse activity"] that could bind and activate Cas9 to form a break at the sequence targeted by the sgRNA. While the CRISPR-Cas9 system can direct scission of the target, any change in sequence is achieved by [ Select ] ["the cells endogenous repair system", "providing cells with DNA recombination proteins"] . Therefore, generating small deletions or insertions is technically [ Select ] ["more difficult", "more feasible"] than precise replacement of a…
Q1 if a eukaryotic cells lack RNA polymerase 2,then which of following can not be synthesized (a)28SrRNA (b)tRNA (c)18SrRNA (d)hnRNA Q2 Acc. to MTP Act,2017 a pregnancy can be terminated by the consent of one medical practitioner within (a)12 weeks of pregnancy (b)12 to 24 weeks of pregnancy (c)24 to 32 weeks of pregnancy (d)32 to 36 weeks of pregnancy Q3 BIOFERTILIZERS ARE (a)organic compound that are produced by decomposition of biological products (b)organism that enrich the nutrient quality of soil (c)inorganic fertilizers produced by microorganisms (d)byproduct of farmyard animals
Q 1. Download and read the attached review article https://www.ncbi.nlm.nih.gov/pmc/articles/PMC342244/pdf/nar00470-0155.pdf titled: MspI, an isoschizomer of HpalI which cleaves both unmethylated and methylated Hpall sites and answer the following question: Restriction enzymes have many applications from gene cloning to gene activity and mapping. Use the two above mentioned restriction enzymes to study transcriptional silencing (consider Southern blot method for your example)
siRNA and CRISPR/Cas9 each interfere with gene expression by a sequence-directed mechanism. A. Identify the target macromolecule (DNA, RNA or Protein) of a specific siRNA/RISC andCRISPR/Cas9 complexsiRNA:CRISPR/Cas9: B. If a scientist would like to permanently turn off expression of a particular human gene inthe liver for the lifetime of an individual, which of these techniques would bepreferable? Briefly explain why
summarize these results using concise language in a neat table; Control : 5’ ATGTACGCGCGATCACCATACATCATGGCACCCGCTAGCTATTAACATGTTTTTT 3’ This is the coding strand of DNA and hence this DNA sequence is similar to mRNA sequence. So the mRNA sequence is : 5’ AUGUACGCGCGAUCACCAUACAUCAUGGCACCCGCUAGCUAUUAACAUGUUUUUU 3’ Mutant 1: 5’ ATGTACGAGCGATCACCATACATCATGGCACCCGCTAGCTATTAACATGTTTTTT 3’ mRNA sequence 5’ AUGUACGAGCGAUCACCAUACAUCAUGGCACCCGCUAGCUAUUAACAUGUUUUUU 3’ The bold Adenine is the mutated base which is substituted in place of Cytosine. So the codon change from GCG to GAG. GCG codes for Alanine but GAG codes for Glutamic acid. So the amino acid sequence changes. Hence this mutation is missense mutation where a base substitution results in change in amino acid sequence. Mutant 2: 5’ ATGTATGCGCGATCACCATACATCATGGCACCCGCTAGCTATTAACATGTTTTTT 3’ mRNA sequence: 5’ AUGUAUGCGCGAUCACCAUACAUCAUGGCACCCGCUAGCUAUUAACAUGUUUUUU 3’ In this mutation, Cytosine is replace by Thymine and hence the codon…