Differentiate the difference between saturated fat and unsaturated fat. Explain the chemical characteristic or property of a double bonded structure fat, and its difference from a single bonded fat. Provide an example and explain shortly.

Q: J A positive result for Fohl's test is the formation of a black precipitate in the form of lead. O A…

A: Fohl's Tests - This test is performed to detect the presence of amino acid which containing sulfur.…

Q: Question 8 Which of the following IS a Phase Il metabolic reaction? O Fornation of a ketone at a…

A: Question 8 ans:  Phase l metabolism is when a parent drug is converted to polar active mrtabolite…

Q: Briefly describe the following and give examples. 1. Starch 2. Glycogen 3. Protein

A: There are four classes of biological macromolecules: nucleic acids, lipids, proteins and…

Q: Question 2 You are using molecular modelling software to examine the X-ray crystal structure of the…

A: Beta-Adrenoreceptor: They are GPCR and contain seven transmembrane helices. It is widely distributed…

Q: Give the 3 major pathways that eventually become entry points of molecules into the Krebs Cycle.…

A: The Krebs cycle, or citric acid cycle, occurs in the mitochondrion of a cell. The citric acid cycle…

Q: Which of the following is a transition mutation? OG --> T G --> A G --> C

A:

Q: Сно сно CH,OH Fo но H- HO- H- Phosphorogluco- isomerase Phosphofructo- kinase Нехоkinase но H- но…

A: The given pathway represents the glycolytic pathway, through which the glucose molecules are…

Q: What type of spontaneous change to DNA is caused by UV light? deamination

A: Deoxyribonucleic acid (DNA) is a polymer made up of two polynucleotide chains that coil around each…

Q: normone with its blood concentration inereased during physical

A: Growth Hormone is the hormone which increased with its blood concentration increased during physical…

Q: Identify if the following is a pyrimidine/purine nucleotide or a pyrimidine/purine nucleoside and…

A: The structure of pyrimidine/ purine nucleoside or pyrimidine/ purine nucleotide with ribose or…

Q: Which of the following viruses have been used as vectors for gene delivery?

A: Gene delivery is a process of introducing the foreign genetic materials which are DNA and RNA into…

Q: Renata enzymatically conjugates a "C-labeled cysteine to a transfer RNA (IRNA), with a UGU…

A: The genetic codon is the three letter codon that specifies the twenty naturally occurring amino…

Q: How do you calculate RNA concentration?

A: DNA and RNA are made up of long chains of nucleotides. Sugar molecule, ribose in RNA, and…

Q: The pyruvate S lactate reaction in animals is reversible, but the pyruvate S ethanol fermentation in…

A: Pyruvate to lactate reaction takes place in our muscle or other microorganisms while fermentation…

Q: Microbes can provide beneficial activities. Bioremediation (using bacteria) is a process used to…

A: Bioremediation is a waste management technique. Living organisms can be used in this process to…

Q: Which of the following is the polyadenylation signal sequence? AAAAAA O AAUAAA O AAAUAA AAUUAA

A: Polyadenylation signal sequence :- is the signal sequence needed to add poly A tail at 3' end of…

Q: Name FOUR polymers in your body right

A: Polymers are composed of many monomers attached together via covalent bonds. Polymers are made up of…

Q: the enzyme and substrate should be mixed only when the reaction is initiated (when the absorbance…

A: Kinetics is the branch which deals with rate of changes. From above all given situations in the…

Q: Starting with a 4-carbon growing fatty acid attached to the ketoacyl synthase (KSase) site, and a…

A: Fatty acid metabolism includes Fatty acid biosynthesis (an anabolic process) and β-…

Q: Reactions and Thermodynamics of Glycolysis

A: Third step of glycolysis, fructose-6-phosphate is converted to fructose- 1,6-bisphosphate by…

Q: Fructose, sucrose, lactose, xylose, and glucose were tested using Benedict's, Barfoed's, Bial's, and…

A: Carbohydrates are the organic compounds and is the main source of energy for the body. They occur in…

Q: Explain the Glycolysis and Kreb’s Cycle metabolic pathways.

A: Metabolic pathways in biochemistry are series of chemical reactions takes place which are linked…

Q: response. 5. Since in this patient pyruvate kinase is abnormal not only is less pyruvate made but…

A: RBCs are little red blood cells that transport oxygen from the lungs to the whole of the body's…

Q: 1.Antibiotics that are active against G= and G- organisms such as Blank 1, Blank 2, and Blank 3…

A: Hi! Thank you for the question. We are authorized to answer two subparts at a time, since you have…

Q: Retroviral delivery of the gene coding for Combined Immunodeficiency. treats individuals with Severe…

A: Successful gene therapy that is performed with the retroviral vectors neceserily requires robust…

Q: Which of the following is not a similarity between prokaryotic initiation and eukaryotic initiation?…

A: Translation is a process of Synthesis of polypeptide chain from mRNA template by using Ribosomes. It…

Q: 44. Roy's doctor recommended that he watch his blood cholesterol level because his of reading of…

A: In a person, the total level of cholesterol should be always less than 200 mg/dL for a healthier…

Q: Determine the pKa of the amino acid using the graph graph attached:

A: Amino acids contain amino group and carboxyl group along with R side chain. The R side chain defines…

Q: What purpose was served by filtering the milk sample after the addition of acid?

A: Milk is a white color liquid which is consists of various proteins and vitamins. Milk is an…

Q: 2. Which enzyme is used in the estimation of glucose from the blood sample using biosensors? a.…

A: Biosensors are device used that calculates measurable signal for a particular test. Pregnancy tests…

Q: What is cryopreservation? How do we reduce the risk of cell damage from osmolytic pressure in…

A: Cryopreservation is primarily used to preserve biological specimens. Individual cells and biological…

Q: etabolism as a determinant of bioavailability: the first-pass effect

A: Bioavailability is the rate and a particular range of the active ingredient absorption , when it…

Q: If 100% of the free energy from the metabolism of glucose is used for the conversion of ADP to ATP,…

A: The equation for the oxidation of glucose is:

Q: Golden rice is genetically modified to express the following

A: Golden rice is one of the genetically modified variety of rice.

Q: In the RBCs of the patient described above, which of the following would be expected? And give the…

A: Pyruvate  kinase enzyme deficiency typically can manifest clinical symptoms on red blood cells…

Q: Enzymes occasionally display weak "side" activities. Draw the structure of the product (other than…

A: Pyruvate is formed in the last step of glycolysis with release of one ATP per molecule, catalyzed by…

Q: ince in this patient, pyruvate kinase is abnormal not only is less pyruvate made but intermediates…

A: Introduction:  Pyruvate kinase is the last enzymatic reaction in the glycolysis pathway. It is…

Q: Given below is the DNA template. What are the gene products? 3’ TACCGGCCTATCTAGGGCCATGGCTTAATTCCC 5’…

A: DNA is the sequence of Nucleotides that are transcribed into mRNA during transcription. Once DNA is…

Q: H1. Estimate the TKN associated with a sample having 50 mg/L of cell tissue and 10 mg/L of ammonia.…

A: TKN (Total Kjeldahl Nitrogen) test is a method of estimation of total concentration of organic…

Q: 1. How much faster is a reaction with the faster enzyme than without a catalyst? * A. Approximately…

A: “Since you have asked multiple question, we will solve the first question for you. If youwant any…

Q: A homozygous individual has what allele(s) of a particular gene? Select one: a. 2 dominant or 2…

A: An allele is described as an alternative form or version of a gene. An individual inherits two…

Q: TRNA and 5S RNA genes both have the following internal control region. BoxA BoxB BoxC

A: An internal control region is determines as a sequence that is made up of DNA and is located only…

Q: Name and discuss the non-covalent interactions that maintain protein structure.

A: Several noncovalent interactions stabilize the three dimensional structure of a protein and hence…

Q: CH,0-P-O C=o 0. CH;0-P-O CH,OH C=O Ó. HO-C-H H-C-OH H-C-OHO C-H ČH;O-P-O- H-C-OH O CH;0-P-O 0.

A: Glycolysis is the process in which glucose is broken down to produce two molecules of pyruvate, ATP,…

Q: te the structure for a generic triacylglyceride at pH 7.4.

A: ''Since you have asked multiple question , we will solve the first question for you . If you want…

Q: How many chromosomes are there in a body cell of a person with trisomy 21 condition? Select one: О…

A: Trisomy 21 is a genetic chromosomal disorder . Genetic chromosomal disorders are the diesese occurs…

Q: Pyruvate is produced in glycolysis and used by Kreb's Cycle in the mitochondrial matrix. How does…

A: Glycolysis is the process by which glucose is converted to pyruvate along with production of…

Q: CH,0--o CH;0-P-O ČH-OH C=O Ó. 10-C-H H-C-OH H-C-OH O C-H ČH;O-P-0 H-C-OH O CH-O

A: Glycolysis is the metabolic pathway that converts glucose into pyruvic acid.

Q: value the cathode or anode). Protein eins wards Pepsin Lysozyme Hemoglobin Mynolohin IpH 1.0 11.0…

A: On basis of the gel used, electrophoresis is classified into 2 types, Agarose gel…

Q: Some protein kinases are inactive unless they are phosphorylated on key serine or threonine…

A: The activity of many proteins are modulated by post-translational modification of the proteins.