Does every gene mutationcause alteration in the proteinthe gene normally codifies?

Q: List the sequences of the mRNA molecules transcribed from thefollowing template DNA sequences:a. T G…

A: The sequence of DNA that consists of genetic information is transcribed into RNA. The sequence…

Q: What causes mutation? Is it always harmful? • Does a simple change on DNA sequence affect the…

A: DNA or deoxyribonucleic acid is the genetic material in living organisms. It is composed of…

Q: Why protein is mutated?

A: Proteins are the building blocks of the cell. They are polypeptides made up of monomeric unit amino…

Q: Explain why mutations occur in the CFTR?

A: The CFTR gene provides instructions for making a protein called the cystic fibrosis transmembrane…

Q: what are disease-causing mutations? Explain with  suitable exaamples

A: Mutations are the alterations or the changes that occur in the DNA. Mutagens are the agents that are…

Q: A mutation occurred that changes the sequence of DNA from: 5’ACGTCATGGATAGTGCGTAAACTA3’ to…

A: Mutations are abrupt changes in DNA only one ways has been changed the original DNA.

Q: Explain point  mutations and frameshift mutations. Which is more apt to disrupt the  structure and…

A: Proteins are the expression of the information present in the DNA (deoxyribonucleic acid). This…

Q: describe the different types of mutations?

A: Genetic material is nothing but the sequence of nucleic acids which is called as DNA. It contains…

Q: Mutations are heritable alterations in the base sequenceof DNA.?  TRue or False

A: The genetic material can be DNA or RNA. In eukaryotes, DNA is the genetic material that is present…

Q: Classify the type of mutation that have taken place: silent, missense and nonsense as a result of a…

A: The mutation occurs when there is a change in the nucleic acid sequence. These mutations could be…

Q: how Mutations can alter amino acid sequences?

A: Genetic material is nothing but the sequence of nucleic acids which is called as DNA. It contains…

Q: Do missense mutations occur in genes encoding tRNA? Why orwhy not?

A: The sudden, stable, inheritable change in the DNA (Deoxyribonucleic acid) is known as the mutation.…

Q: • Whether a mutation is recessive or dominant to wild typedepends on how drastically the protein…

A: Mutations are defined as the change in the sequence of DNA of an organism due to any environmental…

Q: Distinguish between spontaneous and induced mutations. Whichare more harmful? Which are avoidable?

A: Mutations are sudden change un structure or number of chromosome.It may occur in extra chromosomal…

Q: Gene mutations ultimately alter protein structure. In whichregion of a carrier protein would a…

A: Protein structures are translated from the DNA present in the nucleus of the cell. DNA will be…

Q: If the DNA gene is TAC GGT TTA CAG, which amino acids will be put together?

A:

Q: How can you still get a functional protein from frameshift mutation?

A: A mutation is a change in a person's genetic code. Changes as small as the replacement of a single…

Q: Why Spontaneous Mutations Occurat a Very Low Rate?

A: Any permanent alteration in the DNA’s nucleotide sequence is termed as mutation. It may include…

Q: What types of mutations occur (i.e. describe base substitution vs. frameshift, silent, missense, and…

A: A mutation is a permanent change in the sequence of DNA, which occurs during the recombination or…

Q: A point mutation occurs in the middle of the coding sequence for agene. Which types of…

A: Mutation is the process of abrupt changes in the nucleotide sequence or gene in the DNA. Mutation…

Q: Explain Mutations in a gene are colinear with the sequence of amino acids in the encoded…

A: A change in DNA sequence is called Mutation. This may be a result of an error in DNA…

Q: name one kind of mutation that produces an altered protein. what determines wether the altered…

A: Genetic material is nothing but the sequence of nucleic acids which is called as DNA. It contains…

Q: DNA AGAGTTCTGCCCTGTCGATTT mRNA mino Acid Sequence Which kind of protein molecule did this gene make?

A: The order of amino acids from the amino-terminal to the carboxyl-terminal of a protein is generally…

Q: do introns or 3′ untranslated regions of a gene have higher rates of nucleotide substitution?…

A: Introns are the regions that include non-coding regions of the RNA transcript. The introns are…

Q: Define mutation

A: The human body is made up of the complex level of the genome organization. The change in the level…

Q: Which features do insertion sequences and transposons have incommon?

A: Transposons are the mobile DNA segments that can move in the DNA of an organism from one location to…

Q: Does a mutation always result in a change of an amino acid sequence in protein? Why?

A: A mutation is the alteration of the nucleotide sequence of the genome which may or may not result in…

Q: What's the mRNA sequence? amino acid sequence?

A: Mutated DNA Sequence - TACGACCTTGGCGACGACT mRNA Sequence - AUG CUG GAA CCG CUG CUG A Amino Acid…

Q: Describe two cellular mechanisms that can prevent mutationsfrom occurring.

A: Mutations are changes in the DNA sequence. Mistakes in DNA replication can result in mutations.…

Q: Defi ne a mutation and explain how mutant forms are identifi ed

A: A genome is a set of genetic instructions for an organism. DNA nucleotide sequences make up this…

Q: What exactly are mutations? Can mutations have helpful effects, harmful effects or no effects at…

A:

Q: .GTCTCTTGACATTG... 3' the nucleotide highlighted in yellow is mutated to a C, what consequence will…

A: Mutations are changes that occur in the genetic sequence of an organism. These mutations have an…

Q: A single base mutation in a gene may not 'always'result in loss of grain of function?

A: The mutation is defined as a sudden, heritable, and stable change in the genome of an organism.

Q: DNA: CATCTACAAATAGCACCTAATTGTG What would be the MRNA:? Protein? Phenotype?

A: CAT  CTA  CAA  ATA  GCA  CCT  AAT  TGT  G           (DNA)

Q: How can post-translational modifications regulatethe activity of an enzyme?

A: PTMs or post-translational modifications are a very common way to regulate the activity of enzymes,…

Q: A protein was mutated at amino acid position 129. Which of the following mutations will least effect…

A: All amino acids share different properties.

Q: . Describe how missense mutations were used to showthat genes determine the amino acid sequences…

A: Alteration in the DNA sequence of the cell is known as a mutation. Various types of mutations found…

Q: 6. If the first G changes to A what kind of mutation will happen? Show the change in amino acid…

A: Introduction :- A mutation occurs when the sequence of DNA changes. Mutations can occur as a result…

Q: What happens when one nucleotide pair is lost from themiddle of the coding sequence of a gene?

A: Gene is a stretch of DNA that codes for a particular polypeptide chain.

Q: ase describe the structural components of a gene?

A: Genes specify the structure of proteins that ar liable for the phenotype related to a selected gene.…

Q: What’s the difference between a point mutation and a SNP?

A: Mutations are defined as the change in the sequence of DNA of an organism due to any environmental…

Q: What type of proteins do redundant genes often specify?

A: Gene redundancy is when a biochemical function is encoded by two or more genes in a redundant…

Q: With regard to mutations, what is meant by the terms“harmful,” “beneficial,” and “neutral”? Why it…

A: Harmful Mutations: - Mutations which lead to a change in amino acid sequence such that either a…

Q: 6. [1] Given the DNA strand, GGACTGATT which of the following is its complementary mRNA? a CCTGACTAA…

A: Transcription Transcription is a process in which the DNA(deoxyribonucleic acid) is transcribed into…

Q: Any mutation inside or outside a coding regionthat reduces or abolishes protein activity in one of…

A: It is one of the types of mutations subclassified on the basis of the effects on the function of…

Q: Is there any function for an intron?

A: DNA is the genetic material that carries genetic information in the form of coded nucleotide…

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.