Match the following molecules to the correct description. DNA [ Choose ] [Choose ] exons, introns and splicing TRNA RNA interference deoxyribonucleotides anticodon and amino acids linear DNA replication ribosomes and protein translation 7-methyl guanosine cap and polyA tail FRNA MRNA [Choose ] pre-MRNA [ Choose ] Telomeres [ Choose ] >

Match the following molecules to the correct description. DNA [ Choose ] [Choose ] exons, introns and splicing TRNA RNA interference deoxyribonucleotides anticodon and amino acids linear DNA replication ribosomes and protein translation 7-methyl guanosine cap and polyA tail FRNA MRNA [Choose ] pre-MRNA [ Choose ] Telomeres [ Choose ] >

Name: Match the following molecules to the correct description.DNA[ Choose
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Match the following molecules to the correct description.DNA[ Choose ][ Choose ]exons, introns and splicingTRNARNA interferencedeoxyribonucleotidesanticodon and amino acidslinear DNA replicationFRNAribosomes and protein translation7-methyl guanosine

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 17QP: Given the following mRNA, write the double-stranded DNA segment that served as the template....

See similar textbooks

Similar questions

Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:
Transcribe the corresponding mRNA strand from the given DNA strand: DNA: TAC GCA CCC AGC CTA TCC GTC ATT mRNA: Complete the corresponding DNA strand from the mRNA strand: DNA: mRNA: AUG ACU GCG CCC CGA UCC UGU UAA Translate the following mRNA sequence into its appropriate amino acid sequence: (abbreviate amino acids by first three letters. Example: Methionine abbreviates to MET mRNA: AUG CUU AGC ACU GUU GAU UAU UCG Given the amino acid sequence, complete a possible DNA strand that compliments the strand: DNA: mRNA: Amino Acids: Met – Lys – Pro – Arg – Ser – Leu - STOP
The following DNA sequence is found on a chromosome in rice plants: 5’ ACCTTGCTCACATGTGGCGTACCTTTCCGTCTATCTGAACAC 3’ What is the amino acid sequence of the longest protein that could be made from this stretch of DNA, assuming that this strand of DNA is the non-template strand? (Remember that the start of translation requires the sequence AUG in the mRNA and “STOP” is not an amino acid.)
Please write the sequence of the mRNA transcript transcribed from the given DNA double helix by indicating template and non template strands.(SLO1)5’-ACGGCATGCATGGTTTAAAAGGGGCCCAAAA-3’3’-TGCCGTACGTACCAAATTTTCCCCGGGTTTT-5’
The sequence below shows a mRNA sequence derived from a template strand of a DNA molecule: DNA sequence 1: CTTTTTTGCCAT DNA sequence 2: ACATCAATAACT DNA sequence 3: TACAAGGGTTCT Determine the mRNA sequence that you would derive from transcription of each strand Using the genetic code table, show the amino acid sequence that will be encoded by these mRNAs For the 3 DNA sequence, what will be the sequence of the complementary base after the process of replication?
A strand of DNA contains this nucleotide sequence: TACTGCCTCCCCATAAGAATT. The corresponding nucleotide sequence of the mRNA strand from this DNA template is as follows: AUGACGGAGGGGUAUUCUUAA. Q: What is the amino acid sequence of the polypeptide that is produced form the mRNA strand? As well, draw a labelled diagram of the mRNA molecule being transcribed from this strand of DNA.
Template strand of DNA is: 3’ TACATAACCGGGCCCATATCGGCCATTTGC5’. 2a). Following transcription, what is the total number of codons in the mRNA transcript? 2 b). Where is the start codon located in this mRNA transcript? 2c). Following translation of this mRNA transcript, how many amino acids will the proteincontain and identify the amino acids sequence of this gene from a genetic code table*.*Note= using a genetic code table
transcribe the following DNA strand into mRNA and translate that strand into a polypeptide chain, identifying the codons, anticodons, and amino acid sequence. DNA: T T T A C G G C C A T C A G G C A A T A C T G G mRNA: Codon: Anitcodon:
The following sequence is a double stranded DNA. 5'ATTTGACAATGCGTTAGGCATGACTATGTATAATGCATGCCACATACT... 3' 3'TAAACTGTTACGCAATCCGTACTGATACATATTACGTACGGTGTATGA…5' -35 -10 +1 Where does RNA polymerase initially binds?
Translate and transcribe the following DNA molecules DNA:AATACGGGGGCGTAACCACTA mRNA: amino acids:
The template strand of a double helical segment of DNA consists of the following sequence: 5’-GTAGCCTTAAGCGATCACCGTCCGTATTACTAGTGGCCAGACTCTTTTCACTCTCATGTATAGTTG-3’ Following translation process, what is the amino acid sequence that will be coded for? (show your answer using THREE-letter amino acid code starting from N-terminus to C-terminus)
The template strand of a double helical segment of DNA consists of the following sequence: 5’-GTAGCCTTAAGCGATCACCGTCCGTATTACTAGTGGCCAGACTCTTTTCACTCTCATGTATAGTTG-3’ Following translation process, what is the amino acid sequence that will be coded for? (show your answer using ONE-letter amino acid code starting from N-terminus to C-terminus)