Database System Concepts
7th Edition
ISBN: 9780078022159
Author: Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan
Publisher: McGraw-Hill Education
expand_more
expand_more
format_list_bulleted
Related questions
Question
Driver License Exam C++
1Functions with array pointers as input parameters.
2. Functions that return an array of type pointer.
3.
Driver’s License Exam
The local Driver’s License Office has asked you to write a program that grades the written portion of the driver’s license exam. The exam has 20 multiple choice questions.
Here are the correct answers:
1. A
2. D
3. B
4. B
5. C
6. B
7. A
8. B
9. C
10. D
11. A
12. C
13. D
14. B
15. D
16. C
17. C
18. A
19. D
20. B
Your program should store the correct answers shown above in an array. It should ask
the user to enter the student’s answers for each of the 20 questions, and the answers
should be stored in another array. After the student’s answers have been entered, the
program should display a message indicating whether the student passed or failed the
exam. (A student must correctly answer 15 of the 20 questions to pass the exam.) It
should then display the total number of correctly answered questions, the total number
of incorrectly answered questions, and a list showing the question numbers of the
incorrectly answered questions.
Input Validation: Only accept the letters A, B, C, or D as answers.
Expert Solution
This question has been solved!
Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.
Step by stepSolved in 2 steps with 4 images
Knowledge Booster
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, computer-science and related others by exploring similar questions and additional content below.Similar questions
- C++ Use 2 D arrays String and float Make simplearrow_forwardC++ Create a function that will read the following .txt file contents and put them into an array: "apple", "avocado", "apricot","banana", "blackberry", "blueberry", "boysenberry","cherry", "cantaloupe", "cranberry", "coconut", "cucumber", "currant","date", "durian", "dragonfruit","elderberry",arrow_forwardc++ code Screenshot and code is mustarrow_forward
- C++ Code: This function will print out the information that has been previously read (using the function readData) in a format that aligns an individual's STR counts along a column. For example, the output for the above input will be: name Alice Bob Charlie ---------------------------------------- AGAT 5 3 6 AATG 2 7 1 TATC 8 4 5 This output uses text manipulators to left-align each name and counts within 10 characters. The row of dashes is set to 40 characters. /** * Computes the longest consecutive occurrences of several STRs in a DNA sequence * * @param sequence a DNA sequence of an individual * @param nameSTRs the STRs (eg. AGAT, AATG, TATC) * @returns the count of the longest consecutive occurrences of each STR in nameSTRs **/ vector<int> getSTRcounts(string& sequence, vector<string>& nameSTRs) For example, if the sequence is AACCCTGCGCGCGCGCGATCTATCTATCTATCTATCCAGCATTAGCTAGCATCAAGATAGATAGATGAATTTCGAAATGAATGAATGAATGAATGAATGAATG and the vector namesSTRs is…arrow_forwardWrite in C++ 1. Define a struct for a soccer player that stores their name, jersey number, and total points scored. 2.Using the struct in #1, write a function that takes an array of soccer players and its size as arguments and returns the average number of points scored by the players. 3.Using the struct in #1, write a function that takes an array of soccer players and its size as arguments and returns the index of the player who scored the most points. 4.Using the struct in #1, write a function that sorts an array of soccer players by name. 5.Using the struct in #1, write a function that takes an (unsorted) array of soccer players and its size and a number as arguments, and returns the name of the soccer player with that number. It should not do any extra unnecessary work. 6.Define a function to find a given target value in an array, but use pointer notation rather than array notation whenever possible. 7.Write a swap function, that swaps the values of two variables in main, but use…arrow_forwardIn C write a grading program as follows.- Ask the user for the number of students and store it in an integer variable.- Create an array of floats with four rows and columns equal to the number of students storedearlier.- Initialize the array to zeros.Create a menu with the following options (use a do-while loop and repeatedly display the menu):A or a to add student info one student at a timeT or t to display class average for homeworkS or s to display class average for quizzesB or b to display class average for examsZ or z to exit program (program repeats until this exit command is entered)arrow_forward
- Write a program in C as follows:- Create an array of integers named “toy” that has 120 rows and 4 columns.- The program should repeatedly display the following menu:A or a to add a toy to the bagV or v to calculate and display the total value of the toysW or w to calculate and display the total weight of the toysD or d to delete a toy from the arrayM or m to calculate and display the number of small toysN or n to calculate and display the number of medium toysL or l to calculate and display the number of large toysX or x to start filling a new bagP or p to exit program - Santa’s bag can hold 30 large toys or 60 medium toys or 120 small toys or any combination ofsizes that satisfy this requirement (ex: 29 large + 1 medium + 2 small would be max capacity).Also, the total weight of toys cannot exceed 620 Kgs. All values are entered in centimeters andgrams. (Hint: the return values of the size function should help you in calculating the bagcapacity.)The…arrow_forwarduse c++ Programming language Write a program that creates a two dimensional array initialized with test data. Use any data type you wish . The program should have following functions: .getAverage: This function should accept a two dimensional array as its argument and return the average of each row (each student have their average) and each column (class test average) all the values in the array. .getRowTotal: This function should accept a two dimensional array as its first argument and an integer as its second argument. The second argument should be the subscript of a row in the array. The function should return the total of the values in the specified row. .getColumnTotal: This function should accept a two dimensional array as its first argument and an integer as its second argument. The second argument should be the subscript of a column in the array. The function should return the total of the values in the specified column. .getHighestInRow: This function should accept a two…arrow_forwardC++ Array Expander -Just do everything in main and make sure you comment each step Use Pointer Notation for the function and within the function. Use a main function and return the pointer from the ArrayExpander function to mainarrow_forward
- C++ programarrow_forwardProgramming Language: C++ I really need help with this question and I keep getting repost answers. Please, someone, help with a genuine understanding of the problem. Code two functions to fill an array with the names of every World Series-winning team from 1903 to 2020, then output each World Series winner with the number of times the team won the championship as well as the years they won them. The input file is attached, along with the main function and screenprint. Please note team names that include two words, such as Red Sox, have an underscore in place of the space. This enables you to use the extraction operator with a single string variable. The following resources are included: Here is main. #include <iostream>#include <fstream>#include<string> using namespace std; // Add function declarations and documentation here void fill(string teams[], int size);void findWinner(string teams[], int size); int main(){ const int SIZE = 118;int lastIndex;string team[SIZE];…arrow_forward
arrow_back_ios
arrow_forward_ios
Recommended textbooks for you
- Database System ConceptsComputer ScienceISBN:9780078022159Author:Abraham Silberschatz Professor, Henry F. Korth, S. SudarshanPublisher:McGraw-Hill Education
Starting Out with Python (4th Edition)Computer ScienceISBN:9780134444321Author:Tony GaddisPublisher:PEARSON
Digital Fundamentals (11th Edition)Computer ScienceISBN:9780132737968Author:Thomas L. FloydPublisher:PEARSON 
C How to Program (8th Edition)Computer ScienceISBN:9780133976892Author:Paul J. Deitel, Harvey DeitelPublisher:PEARSON
Database Systems: Design, Implementation, & Manag...Computer ScienceISBN:9781337627900Author:Carlos Coronel, Steven MorrisPublisher:Cengage Learning
Programmable Logic ControllersComputer ScienceISBN:9780073373843Author:Frank D. PetruzellaPublisher:McGraw-Hill Education
Database System Concepts
Computer Science
ISBN:9780078022159
Author:Abraham Silberschatz Professor, Henry F. Korth, S. Sudarshan
Publisher:McGraw-Hill Education
Starting Out with Python (4th Edition)
Computer Science
ISBN:9780134444321
Author:Tony Gaddis
Publisher:PEARSON
Digital Fundamentals (11th Edition)
Computer Science
ISBN:9780132737968
Author:Thomas L. Floyd
Publisher:PEARSON
C How to Program (8th Edition)
Computer Science
ISBN:9780133976892
Author:Paul J. Deitel, Harvey Deitel
Publisher:PEARSON
Database Systems: Design, Implementation, & Manag...
Computer Science
ISBN:9781337627900
Author:Carlos Coronel, Steven Morris
Publisher:Cengage Learning
Programmable Logic Controllers
Computer Science
ISBN:9780073373843
Author:Frank D. Petruzella
Publisher:McGraw-Hill Education