Exon 2 DNA Intron Intron Exon 3 Exon 1

Q: For each, choose either replication, transcription, or translation. Okazaki fragment [ [ Choose ]…

A: The three main processes of central dogma of molecular biology are replication, transcription, and…

Q: Complete the following chart. Region Length Multiples of 3?

A: RNA is abbreviated as ribonucleic acid and it is composed of a ribose sugar, which is attached with…

Q: Addition of a 5'7-methyl guanosine cap to the primary RNA transcript during nuclear processing *…

A: In eukaryotes, the mRNA when transcribed from DNA comes as a pre-mRNA that undergoes the following…

Q: Refer to Figure 9.7, then translate the following mRNA nucleotide sequence into an amino acid…

A: Ribonucleic‌ ‌acid‌ ‌(RNA)‌ ‌‌also‌ ‌contains‌ ‌genetic‌ ‌material‌ ‌but‌ ‌rarely‌ ‌takes‌ ‌part‌…

Q: Given the following mRNA codons and amino acids, construct a polypeptide from this DNA strand.…

A: Central dogma is the process where in the information stored in nucleic acids is transferred to…

Q: If the template DNA is 3' A GCTAC5' then the mRNA sequence is

A: Ans- As mentioned the DNA template 3’ – A G C T A C – 5’ The mRNA sequence will be – a)          5’…

Q: a. Indicate whether point C is a 5' end or a 3' end of a nucleic acid. b. Indicate which strand…

A: The ribonucleic acid was the primary genetic material. It acts as a genetic material furthermore as…

Q: Match the following: choices: transcription factor

A: Transcription is the process of synthesizing RNA from genetic information stored in DNA. There are…

Q: Order of bases in DNA Order of bases in MRNA (codon) AUC Order of bases in tRNA TAG Amino acid coded…

A: Amino acids are the smallest monomers which are known to form the polypeptide sequence of the…

Q: Examine the following sequence of DNA 3’-CTA – TAC – TTA – CGC – GTA – CAT – GCG – TGA – CCC - ACG –…

A: The central dogma is a metabolic process where the  DNA acts as genetic material and transcripted…

Q: The following sequence represents a few codons present in one strand of DNA.Using this strand of DNA…

A: DNA replication is the process of formation of copies of DNA. It takes place in nucleus of cell.…

Q: Use the chart below to find the correct amino acids for the following mRNA strand: GCUAUGUUU…

A: The process of producing protein by association of mRNA and ribosomes is called translation. The…

Q: Convert the DNA template to mRNA. Then, convert the mRNA to tRNA. Based from the resulting sequence…

A: Introduction :- The proteins are synthesized with the help of protein synthesizing machinery which…

Q: The synthesis of multiple different protein isoforms from just one gene in eukaryotic cells would…

A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…

Q: The following diagram illustrates a step in the process of translation. Identify the following…

A: Translation process in cells includes the synthesis of proteins that are made up of amino acids.…

Q: In Figure 14-9, how are the positions of codonsdetermined?

A: Ans: Codon: The set of trinucleotide sequence of DNA or RNA is referred to as codon.

Q: This is the non-template strand of a double stranded DNA. RNA is transcribed from using one of the…

A: DNA serves as the genetic material and carries genetic information from one generation to another.…

Q: The following diagram illustrates a step in the process of translation. Identify the following…

A: The translation is a process through which the mRNA, transcribed from the template strand of the…

Q: Self-splicing introns are called ribosomes splicing enhancers ribozymes intron silencer

A: Self splicing introns : These can catalyze their own excision from the mRNA, the tRNA, rRNA…

Q: Match each function to the appropriate type of RNA. Messenger RNA (MRNA) Ribosomal RNA (1RNA)…

A: Introduction :- Transcription is the process of synthesis of different types of RNA molecules from…

Q: The anticodon loop of the first tRNA that will complement this MRNA is Select one: O a. 5'-ACG-3' O…

A: Messenger RNA (mRNA): mRNA is a single-stranded RNA molecule that is complementary to one of the DNA…

Q: create a summary of the nucleotide pairs during the translation process

A: Answer: Introduction: Translation process occurs in ribosomes of cytosol or membrane of the…

Q: For the following DNA sequence: 3’–CGATACGGCTATGCCGGCATT–5’ Write: b) the sequence of the…

A: The given DNA sequence is as follows 3’–CGATACGGCTATGCCGGCATT–5' The above given strand is a…

Q: Complete the table below: DNA DNA Complimentary Strand  mRNA sequence  tRNA sequence  Amino…

A: Deoxyribonucleic acid is a molecule composed of two polynucleotide chains that coil around each…

Q: Adds nucleotides in in the 5' to 3' direction during transcription. [Select ] [ Select ] ligase…

A: RNA polymerase

Q: Which of the following units recognize UAG, UAA, and UGA codons? (Single answer) Elongation factors…

A: Genetic code is the combination of 3 nucleotide (called nucleotide triplet or codon) where each…

Q: Below is the 5’–3’ strand of a double-stranded DNA molecule with the following nucleotide sequences:…

A: Central dogma refers to the process by which information stored in a DNA molecule is converted into…

Q: Convert the DNA template to mRNA.  Then, convert the mRNA  to tRNA. Based from the resulting…

A: Central dogma- RNA is produced from DNA with the help of transcription and then RNA is converted to…

Q: Use the codon wheel on page 10.11 to identify any stop codons in the stop codons. Use the codon…

A: During transcription process RNA is formed with the help of complementary base pairing with template…

Q: Explain the function of 7-methyl guanosine at 5' end of RNA transcript during initiation of…

A: After transcription, when the primary transcript has just been formed, it undergoes post…

Q: Table 8.2: Transcription and translation of the first 7 codons in the B-globin chain of hemoglobin.…

A: Change in the DNA sequence can causes alternation of the amino acid sequence. This can causes an…

Q: Below is the sequence of an mRNA that has just been transcribed. Please translate this sequence as…

A: Let's rearrange the mRNA in the codes of three.  ACG UCC AAU GGC AGU GAU UUG AAU CCA ACG codes for…

Q: Complete the following table: Type of RNA Functions Transfer RNA (tRNA)     In a ribosome,…

A: Macromolecules are very large molecules commonly composed of the polymerization of smaller subunits…

Q: You’re working in Marshall Nirenberg’s lab, trying to decipher the genetic code. You use several…

A: Marshall Nirenberg studied the genetic codes for protein synthesis in his biochemical research. He…

Q: Splicing involves excision of introns excision of exons addition of exons addition of introns

A: An intron is a portion of a gene that does not code for amino acids.The parts of the gene sequence…

Q: Using a codon table, complete the DNA triplets, mRNA codons, tRNA anticodons, and amino acids in the…

A: Genetic code is in triplets and the codes are read by the anticodon and thus the amino acids are…

Q: Using the following DNA template code, which of the following tRNA anticodons would carry the 4th…

A: Introduction DNA:-  (Deoxyribonucleic acid) It is a long molecule that contains our unique genetic…

Q: Write:           A – if the item is associated with Transcription           B – if the item is…

A: Introduction  Gene expression is the process through which a gene's information is used to create a…

Q: The following diagram illustrates a step in the process of translation. Identify the following…

A: Translation process in cells includes the synthesis of proteins that are made up of amino acids.…

Q: Here is a schematic map with a scale of a eukaryotic gene. How long is the primary mRNA transcript…

A: The mRNA is produced by the process of transcription.

Q: If an mRNA nucleotide is synthesized from DNA, how do you identify the:   5’end; 3’ UTR;…

A: The promoter sequence serves as a site for binding of RNA (ribonucleic acid) polymerase. It is…

Q: Choose one of the strands and transcribe the strand. Show the steps (with proper label) and do a…

A: Transcription  Formation of RNA over DNA template is called transcription.  Translation The process…

Q: Order of bases in DNA Order of bases in MRNA Order of basea in tRNA (anticodon) Amino acid coded…

A: DNA molecules are the carriers of genetic information in nucleus of a cell. The DNA undergoes the…

Q: Put the following steps in the proces transcription in chronological order. RNA splicing [ Choose ]…

A: Initiation, elongation, and termination are the three stages of transcription.

Q: The following diagram illustrates a step in the process of translation. Identify the following…

A: Translation is the process of formation of protein from mRNA As in the question above start codon is…

Q: Gene 1 TACTTGTTTACATAACTTTGAATT Step 1. Transcribe the DNA to MRNA Step 2. Draw lines to separate…

A: Genes are known as the hereditary units of life. They encode different proteins that are utilized to…

Q: Coding strand CGT CTC TTC GGA CAC whar is the mRna strand

A: The process of formation of mRNA sequence  from the template strand of DNA is known as…

Q: The following diagram represents DNA that is part of the RNA-coding sequence of a transcription…

A: Transcription is a process through which the template strand of DNA transcribes into mRNA with the…

Q: Provided below are strands of DNA. The first one has been done for you. First transcribe the code…

A: Answer: CENTRAL DOGMA = It is the complete process of replication of DNA , transcription of RNA ,…

Q: DNA TAC - GGC - GAA - TCC - CCA - GTA - TCC - ATT ТСС - ТСС - АTT (gene) MRNA AUG Amino Acid Met…

A: DNA => Transcription => mRNA => Translation => Protein Transcription: Formation of RNA…