The anticodon loop of the first tRNA that will complement this MRNA is Select one: O a. 5'-ACG-3' O b. 3'-UGC-5' O c. 5'-UGC-3' O d. 5'-GGC-3' O e. 3'-GGC-5'

Q: Suppose that a gene underwent a mutation that changed a GAA codon to UAA. (a) Name the amino acid…

A: Mutation is the sudden heritable changes that occur in the DNA sequences due to error while…

Q: Match Column A with Column B. |Intron is removed from the MRNA transcript A 1st event v MRNA is…

A: Transcription is the mechanism by which mRNA is produced from template DNA in molecular biology. As…

Q: Alternate splicing: A. Reduces mRNA half-life by shortening poly(A) tails B. Disrupts histone…

A: Introduction In Molecular Biology, RNA Splicing Is The Process By Which A Newly Synthesised…

Q: Convert the DNA template to mRNA. Then, convert the mRNA to tRNA. Based from the resulting sequence…

A: Introduction :- The proteins are synthesized with the help of protein synthesizing machinery which…

Q: . Suppose that a gene underwent a mutation that changed a GAA codon to UAA. (a) Name the amino acid…

A: A codon is a sequence of three DNA or RNA nucleotides that corresponds with a specific amino acid or…

Q: The “A” site in the ribosome refers to the:     A. binding site for charged t-RNA molecules…

A: According to the question, we have to find out the function of the "A" site in the ribosome from the…

Q: The portion of the mRNA that is removed during splicing is (a) an inverted repeat (b) the promoter…

A: The protein synthesis is a process which involves two steps transcription and translation .…

Q: During translation, when a stop codon is read on the mRNA strand at the ribosome...  a the mRNA is…

A: Activation (getting ready), initiation (getting started), elongation (getting longer), and…

Q: a. The right side shows the ribosome with an empty A site aligned with the codon 5’UAU 3’. The next…

A: When the DNA that is already transcribed to RNA inside the cell ribosomes helps this mRNA to…

Q: Some events that take place in proteins synthesis are shown below: A. An enzyme reads the gene…

A: TRANSCRIPTION It is the process of transfer of sequence information from DNA  to RNA . The DNA…

Q: The portion of the mRNA transcript that gets removed duringRNA processing is thea. exons.b.…

A: Ans: RNA processing: The post transcription processing in eukaryotes is referred to as RNA…

Q: The primary function of RF1 during translation is to:   a. recognize a stop codon in the 70S A…

A: The translation is the process of translating genetic information in the form of proteins. It…

Q: For translation of eukaryotic mRNA sequences: a) The stop codon stops translation by blocking the…

A: Translation refers to the process of polymerisation of amino acid to form a polypeptide. The order…

Q: The IRNA that was in the P site moves into the A site C. The tRNA that was in the A site moves to…

A: The process of protein synthesis is called translation. In this process transfer RNA, messenger RNA…

Q: Choose best match of the events that occur during translation with their locations in the E. coli…

A: Translation is the process by which the genetic code on messenger RNA (mRNA) molecules is decoded to…

Q: Which two sequences shown in the diagram are NOT directly transcribed from the template strand of…

A: ANSWER - in this figure the following sequences are not directly transcribed from the template…

Q: 1. A tRNA has the anticodon sequence: 5'-IGC- 3'. which codon will not decipher with this tRNA? a)…

A:

Q: The anticodon of a particular tRNA molecule is(A) complementary to the corresponding mRNA codon.(B)…

A: The heart of protein synthesis is the translation of nucleotide sequence information in the form of…

Q: In the triplet-binding assay of Nirenberg and Leder, an RNA triplet composed of three bases was able…

A: Introduction  In 1964, two eminent scientists Marshall W. Nirenberg and Philip Leder carried out the…

Q: a. Write the sequence of the MRNA synthesized from the upper strand. b. Indicate the 5'and 3'ends of…

A: Answer : a. Sequence of mRNA synthesized from the upper stand - 5' AUGCCAUUUUGA 3' b. 5' and 3' ends…

Q: Convert the DNA template to mRNA.  Then, convert the mRNA  to tRNA. Based from the resulting…

A: Central dogma- RNA is produced from DNA with the help of transcription and then RNA is converted to…

Q: A single template strand of a DNA molecule is represented by  3’atgtaccatgcgcaaatttaaaggccc5’. a)…

A: Transcription is the process in which RNA is synthesized from DNA.

Q: What will be the anticodon of the next tRNA added to the A site of the ribosome?

A: Codons are situated in on mRNA and anticodons are situated on tRNA.

Q: Translation of mRNA is terminated at the stop codon by:   A. binding of the Release Factor to stop…

A: The translation is the process, in which the new growing polypeptide chain is synthesized.

Q: In which site(s) of the ribosome could you find a tRNA with more than one amino acid bound (a…

A: Introduction :- The peptidyl transferase is an aminoacyltransferase and the principal enzymatic…

Q: Which part of a tRNA molecule acts as an amino acid attachment site?   a. the 5' end   b.…

A: tRNA (transfer ribonucleic acid) molecule escorts amino acids to their correct location in a…

Q: the chemical group responsible for nucleophilic attack in translational elongation is  a) free…

A: Translation:        It involves decoding a messenger (mRNA) and using it's information to build a…

Q: Below is a diagram of charged TRNAS in the active site of the ribosome during translation of the…

A: Each aminoacyl-tRNA synthetase's active site functions as a "lock and key" for an associated tRNA…

Q: During ______, the amino acid connected to the tRNAat the P site forms a peptide bond with the amino…

A: During translation, polypeptide chain is produced in ribosome by adding amino acids one by one.

Q: double-stranded helix

A: After mRNA synthesis there are post transcriptional processes which converts the heterogenous…

Q: A scientist mutates eIF-2 to eliminate its GTP hydrolysis capability. How would this mutated form of…

A: Selection of the AUG start codon for translation in eukaryotes is governed by codon-anticodon…

Q: The anticodon of a tRNA is located in the a. 3′ single-stranded region of the acceptor stem. b. loop…

A: Transcription is a process in which the nucleotide sequences of a gene are transcribed into the RNA…

Q: The tRNA binding site on the ribosome is called Select one: a. E site b. P site c. E P A

A: Ribosomes are membrane less cell components involved in the process of translation (protein…

Q: A segment of DNA has the followimg sequence of bases.. 5'-ATGCAATGATATTGAAGCTTA-3' a) What…

A: Translation is the mechanism by which ribosomes in the cytoplasm or endoplasmic reticulum synthesize…

Q: If a splice site were mutated so that splicing did not take place, what would be the effect on the…

A: Mutation in genetic sequence of RNA is due to deletion, insertion, or any change in the nucleotides,…

Q: A. Taq polymerase B. Release factors C. Reverse transcriptase D. CDNA 1. Catalyzes peptide bond…

A: 1.  H peptidyl transferase  2.  G aminoacyl  tRNA synthetase 3.  K  shine dalgarno sequence 4. I…

Q: tRNAs a. carry amino acids b. bind to the anticodon present in the mRNA c. adapt the genetic…

A: Introduction Transfer RNA (tRNA) is a short RNA molecule that aids in the production of proteins. A…

Q: What is a mechanism that allows the same protein (with the same amino acid sequence) to have…

A: Gene expression is a process in which information that is present in a gene is decoded so as to…

Q: The release factors RF1 and RF2 are required for

A:

Q: During translation

A: The translation involves the synthesizing proteins through ribosomes in the cytoplasm or endoplasmic…

Q: The anticodon …   A. is complementary to the mRNA   B. is found on the ribosome   C. is found…

A:

Q: A. Label each structure as mature mRNA, pre-mRNA, protein, or DNA. B. Label each arrow to indicate…

A: The central dogma depicts the replication of DNA, the transcription of DNA into RNA, and the…

Q: A particular tRNA is mutated so that the amino acid attachment cannot bind with the aminoacyl-tRNA…

A: Protein synthesis happens by a series of events. mRNA transcripted from DNA had the codons. tRNA has…

Q: This type of mutation, where one nucleotide was replaced for another, is called a point mutation.…

A: DNA and RNA are are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid…

Q: The site on the ribosome complex which binds the new incoming amino acid- TRNA is called the A P…

A: Introduction Translation is the process by which ribosomes in the cytoplasm or endoplasmic reticulum…

Q: triplet of bases on an mRNA molecule is known as a(n)

A: A triplet of bases on an mRNA molecule is known as a(n) Answer: c)  codon.

Mitochondrial Mutations

A mitochondrion is a cellular organelle that serves as the site for cellular respiration and energy production (ATP or Adenosine Triphosphate). It is a double-membrane-bound organelle and is only present in eukaryotic cells.