Expansion of a CAG repeat region by 1 repeat is an example of a frameshift mutation. Both DNA polymerase and RNA polymerase read their template strand in a 3'->5' direction. A silent mutation can create a RFLP.
Q: The following sequence of nucleotides is found in a single-stranded DNA…
A: DNA is the double-stranded molecule that is the genetic material in most animals except for some…
Q: . The table opposite shows the standard (coding strand) DNA rinlet codes for the 20 amino acids…
A: Introduction :- The process of protein synthesis occurs in two steps which are transcription and…
Q: a. Indicate whether point C is a 5' end or a 3' end of a nucleic acid. b. Indicate which strand…
A: The ribonucleic acid was the primary genetic material. It acts as a genetic material furthermore as…
Q: In the diagram shown below representing a replisome, the portion represented by the letter functions…
A: Ans. The method of DNA replication is a process in which double-strand DNA molecule copying in order…
Q: DNA primase synthesizes a short RNA primer that later appears at the 5'-end of each Okazaki…
A: The given statement is TRUE
Q: A researcher was mutating prokaryotic cells by inserting segments of DNA. In this way, she made the…
A: a.) Mutant is the palindromic sequence for original construct. Palindromic sequences are those…
Q: Transposons are useful as mutagens because they act asmolecular tags for genomic DNA sequences that…
A: Step 1 Transposons or jumping gene is a DNA (deoxyribonucleic acid) sequence that can change its…
Q: The following sequence of nucleotides is found in a single-stranded DNA template:…
A: The process of formation of mRNA from DNA is called transcription.
Q: Consider which of the five mutations is most likely to cause Duchenne muscular dystrophy in this…
A: Duchenne muscular dystrophy is a disease charecterised by muscular weakness due to lack of a protein…
Q: What is a promoter? What is the function of RNA polymerase? How does it differ from DNA polymerase?
A: In the process of transcription, there are several machinery and enzymes involved. This aids in the…
Q: How would nucleotide excision repair be affected if one of the followingproteins was missing?…
A: The process of identification and correction of damaged DNA molecule by a cell which encodes its…
Q: In reverse transcriptase polymerase chain reaction (RT-PCR), an analytical method used to amplify…
A: Reverse transcriptase polymerase chain reaction (RT-PCR) is a method used to amplify and sequence…
Q: In relation to central dogma of molecular biology answer the following questions: The following…
A: Central dogma of molecular biology depicts how information in the DNA is transcribed into RNA and…
Q: Scientists developed a marker technology to examine the function of RNA polymerase in yeast cells.…
A: Transcription process is responsible for producing mRNA. It takes place in the nucleus.
Q: explain strand-slippage replication for STR mutation
A: Kornberg et al. proposed the idea in 1964, and it is also known as DNA slippage, polymerase…
Q: An adult with a history of tanning has his genome sequenced. The beginning of a protein-coding…
A: The main inheritable material is Deoxyribonucleic acid (DNA). It is composed of four nitrogenous…
Q: A particular variant of the lambda bacteriophage has a DNA double-stranded genome of 51,365 base…
A: DNA is a double stranded helical molecule that is made up of repeating nucleotides. The nucleotides…
Q: Process by which the DNA sequences encoding exons are exchanged and reordered through genetic…
A: Exon :- the coding part of the gene. Intron :- the non coding regions of pre mature mRNa.
Q: rmal hemoglobin is created from the codon GAA, which codes for glutamic d while sickle-cell…
A: Any abrupt change in the DNA sequence of nucleotides results in mutation its effects may be diverse…
Q: From standpoint of replication and transcription, explain how RNA polymerase is allowed to…
A: DNA is a double standard molecule. RNA is a single standard molecule. RNA is formed from DNA…
Q: . Locate the -10 region hexanucleotide sequence in the following coding strand of DNA. Indicate…
A: Transcription is a process through which the template strand of the DNA transcribes into mRNA in the…
Q: Is each of the following mutations a transition, transversion, addition,or deletion? The original…
A: Since no specific subparts have been asked to be answered, the first three subparts have been…
Q: Shown below is a drawing showing the result of an experiment in which an RNA molecule is allowed to…
A: DNA is the genetic material in most living organisms. It is the information hub of the cell that…
Q: In which region(s) will Okazaki fragments be found during new strand synthesis? (see image for…
A: Semi replicative mechanism is a type of DNA mechanism which explained the type of replication…
Q: Which of the following best describes this type of mutation? Original – CCU-GAU-GAG-UCA…
A: Introduction : Mutations are modifications to the genetic sequence. Mutations can involve the…
Q: What type of mutation (transition, transversion, or frameshift)would you expect each of the…
A: Mutagens are such agent that changes the genetic material, that is, the structure of DNA…
Q: DNA is made of two strands that are antiparallel. If one strand runs from 3’ to 5’ direction the…
A: Deoxyribonucleic acid (DNA) is a double stranded helical genetic material containing thousands of…
Q: Addition or deletion of bases causes which kind of mutation? Select one: O a. Transversion O b. •…
A: Any heritable change that happens in the nucleotide sequence of the DNA is called a mutation.…
Q: Taq polymerase is a bacterial thermostable DNA polymerase that has a relatively low replication…
A: Taq polymerase is an enzyme used to amplify DNA in Polymerase chain reactions. Taq polymerase is a…
Q: DNA repair systems are responsible for maintaining genomic fidelity in normal cells despite the high…
A: Living organisms are constantly exposed to a variety of DNA-damaging substances that can have an…
Q: A mistake during DNA replication leads to a mutation in the nucleotide sequence shown below. DNA DNA…
A: Mutations are a genetic phenomenon in which alterations in the sequence of nucleotides of DNA occur.…
Q: RNA polymerase from E. coli (core enzyme alone) has all of the following properties except:…
A: RNA polymerase enzyme is a multi subunit enzyme having a catalytically active core.
Q: Several temperature-sensitive mutant strains of E. coli displaythe following characteristics.…
A: D.N.A. bio synthesis -- The synthesis of D.N.A. occurs when a cell divides and during division of…
Q: Faulty DNA repair; ii) Gain-of-function; and iii) Trinucleotide repeats provide genetics disorders…
A: Asked : Example of mutation are asked with disorder for given condition.
Q: Select the statement(s) that accurately describe the function of DNA polymerase and the types of…
A: Mutation is a phenomenon that results in alteration of DNA sequences. This results in changes in the…
Q: A mutation in which of these proteins will lead to increased mutations in all daughter cells? A.…
A: The mutation is a heritable change that arises due to the alteration of the genomic sequence of an…
Q: Below are shown two views of the backbone representation of the Myc-Max complex binding to DNA (PDB…
A: DNA ( Deoxyribonucleic acid) is the hereditary molecule of organism as it flows from one generation…
Q: Compare DNA polymerase and RNA polymerase from E. coli in regard to each of the following features:…
A: Introduction: DNA polymerases are the group of enzymes that catalyze the synthesis of DNA strands…
Q: Huntington’s disease is an inherited neurological ailment with a variable age of onset. A protein…
A: Huntington's disease is a neurodegenerative disorder. The repetition of a CAG trinucleotide causes…
Q: an adult with a history of tanning has his genome sequenced. The beginning of a protein coding…
A: Mutations are the changes in the genetic sequence that may result in genotypic or phenotypic…
Q: Evaluate the mutation below. Original DNA strand: 3'-TACTTACGCACGGCCACT-5' Amino acids produced:…
A: From the DNA sequence the mRNA is produced within the nucleus of the cell by the transcription…
Q: Original DNA template: 3'-ACGGTCAATTTGCTG-5 a) Transcribe the sequence. b) Translate the sequence.…
A: “Since you have posted a question with multiple sub-parts, we will solve first three sub-parts for…
Q: Both function as holoenzymes that have polymerase and helicase activities Both bind promoters Both…
A: Characteristics shared by both RNA polymerase and DNA pol III in E.coli Statement A ) RNA Polymerase…
Q: A mutant DNA strand was transcribed then translated to proteins. a. What is the protein product of…
A: A mutation is an abnormal change in DNA sequences that alters the protein product and is one of the…
Q: Explain why the active site of poly(A) polymerase is much narrower than that of DNA and RNA…
A: Poly (A) polymerase is the enzyme that is an important part of the polyadenylation machinery. It is…
Give answer in:
TRUE OR FALSE
Step by step
Solved in 2 steps
- People with a commonly occurring, wild type allele of PTC with two adjacent thymines at a particular site in the coding sequence are more prone to BCCs than people without this allele. How can this be explained (one sentence)? The "two adjacent thymines" allele of PTC causes a bigger increase in BCC risk for people xeroderma pigmentosum (XP), who lacks components of the nucleotide excision repair pathway, compared to people without XP. How can this be explained (one sentence)?It has been shown that infectious agents such as viruses often exert a dramatic effect on their host cell’s genome architecture. In many cases, viruses induce methylation of host DNA sequences in order to enhance their infectivity. What specific host gene functions would you consider as strong candidates for such methylation by infecting viruses?Extreme UV exposure leads to the SOS response in bacteria. By what mechanism does the SOS response function? Answer choices induction of photolyase and the addition of white light to remove the thymine dimer destruction of lexA, which leads to expression of an alternate, error-prone DNA polymerase homologous recombination repair non-homologous end joining exinuclease removal of a segment of DNA including a thymine dimer, followed by the replacement of DNA using the complementary strand of DNA
- A small section of bacterial DNA template (antisense) strand has the following nucleotide sequence: CGA AAA GAG AAT A mutation in the above sequence involved a substitution of a single base, resulting in an incomplete protein due to a nonsense mutation. Which of the following gen sequences exemplifies the mutation described above? a. CGA UAA GAG AAT b. CGA AAA AAG AAT c. CGA AAA GAG ACT d. UGA AAA GAG AATWhich of the following is NOT true of DNA Methylation. A. DNA methylation is typically correlated to gene repression. B. On a given gene, histone modifications or DNA methylation could be used, but not both at the same gene. C. DNA methylation can be used in mismatch repair to identify the parent strand after DNA replication. D. DNA methylation typically occurs on dCTP nucleotides in eukaryotes. E. DNA methylation can be inherited through mitosis.Below is a sample of a segment of DNA…(copy from left to right) 3’ TACAATGGGCGACGCGCTTCGTTTCAGATT 5’ 5’ ATGTTACCCGCTGCGCGAAGCAAAGTCTAA 3’ 1.Assume the 6th amino acid is changed from T to G on the DNA template strand. What type of mutation is this? What effect would this have on the protein? Look up an example for this type of mutation. 2, Assume the 5th and 6th amino acids are removed from the DNA template strand. What type of mutation is this? How would this affect the protein? Look up an example of this type of mutation. 3.Which mutation changes the protein more...a point mutation or a frameshift mutation. Explain your reasoning. 4.What would be the problem if ATT was inserted into the DNA template strand after the second codon? (Be sure to consult the coding chart for amino acids). 5. What if the second amino acid was repeated over 5Ox. What amino acid is repeated? What type of mutation is this? If this is on chromosome 4, what genetic disorder is this?…
- Genes with highly similar sequence are often located adjacent one another in the genome. Gene duplication commonly arises from errors in replication. When the organization of such adjacent genes is in an inverted orientation, this can reduce the expression of other genes that have similar sequence and are located on other chromosomes. Explain the mechanism of how this generally occurs. Please state the answer in details: what is the mechanism? How it happens? Why this happens? When it happens? And every other necessary information.Which of these pairs of clinical applications of DNA repair mechanisms is not accurate? Group of answer choices Loss of BRCA2 correlates to decreased sensitivity of Breast cancer cells to DNA-damaging agents Loss of BRCA1 expression correlates to Increased sensitivity of Ovarian cancer cells to Cisplatin BRCA1 expression is a marker of survival in Non-Small cell Lung Cancer Patients Defective Homologous Repair correlates to increased sensitivity to Alkylating AgentsA hereditary disease is inherited as an autosomal recessive trait. The wild-type allele of the disease gene produces a mature mRNA that is 1250 nucleotides (nt) long. Molecular analysis shows that the mature mRNA consists of four exons that measure 400 nt (exon 1), 320 nt (exon 2), 230 nt (exon 3), and 300 nt (exon 4). A mother and father with two healthy children and two children with the disease have northern blot analysis performed. The results of the northern blot for each family member are shown below. a) Identify the genotype of each family member, using the size of mRNAs to indicate each allele. (For example, a person who is homozygous wild type is 1250/1250). b) Based on your analysis, what is the most likely molecular abnormality causing the disease allele?
- "While other proteins come and go during the cell cycle, the proteins of the origin recognition complex remain bound to the DNA throughout" is true or false.There may be more than one correct answer for each Which of the following motifs can be found in DNA-binding proteins? a.) helix-loop-helix b.) zinc fingers c.) leucine zippers d.) CpG islands Which of the following motifs can be used to bind protein dimers? a.) helix-loop-helix b.) zinc fingers c.) leucine zippers d.) CpG islands Which of the following are correct regarding enhancers? a.) Enhancers may be located a great distance from the initiation site they regulate. b.) Enhancers can be either upstream or downstream from the initiation site. c.) Enhancers directly bind DNA and prevent binding of activators to the DNA. d.) Enhancers may function in either orientation (forward or backward).Is each of the following mutations a transition, transversion, addition,or deletion? The original DNA strand is 5′–GGACTAGATAC–3′(Note: Only the coding DNA strand is shown.)A. 5′–GAACTAGATAC–3′B. 5′–GGACTAGAGAC–3′C. 5′–GGACTAGTAC–3′D. 5′–GGAGTAGATAC–3′