Below are shown two views of the backbone representation of the Myc-Max complex binding to DNA (PDB ID: 1NPK). Myc and Max are members of the basic helix-loop-helix (BHLH) class of DNA- binding proteins (see Chapter 29). Myc (red) and Max (blue) associ- ate via a coiled-coil interaction and bind DNA as a dimer. Side view of Myc-Max bound to DNA Top view of Myc-Max bound to DNA (looking down the DNA helical axis) (a) Are the helices bound to the DNA likely to be amphiphilic? Explain. (b) Where do you predict the N- and C-termini are located for Max?

Below are shown two views of the backbone representation of the Myc-Max complex binding to DNA (PDB ID: 1NPK). Myc and Max are members of the basic helix-loop-helix (BHLH) class of DNA- binding proteins (see Chapter 29). Myc (red) and Max (blue) associ- ate via a coiled-coil interaction and bind DNA as a dimer. Side view of Myc-Max bound to DNA Top view of Myc-Max bound to DNA (looking down the DNA helical axis) (a) Are the helices bound to the DNA likely to be amphiphilic? Explain. (b) Where do you predict the N- and C-termini are located for Max?

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 16QP: Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also,...

See similar textbooks

Similar questions

Consider the following sequence of DNA: 3'-TTA CGG-5'What dipeptide is formed from this DNA after transcription and translation? b. If a mutation converts CGG to CGT in DNA, what dipeptide is formed? c. If a mutation converts CGG to CCG in DNA, what dipeptide is formed? d. If a mutation converts CGG to AGG in DNA, what dipeptide is formed?
Myc and Max are members of the basic helix-loop-helix (bHLH) class ofDNA-binding proteins. Myc (red) and Max (blue) associate via a coiled-coilinteraction and bind DNA as a dimer.(a) Are the helices bound to the DNA likely to be amphiphilic? Explain.(b) Where do you predict the N- and C-termini are located for Max?Explain your rationale.
There may be more than one correct answer for each Which of the following motifs can be found in DNA-binding proteins? a.) helix-loop-helix b.) zinc fingers c.) leucine zippers d.) CpG islands Which of the following motifs can be used to bind protein dimers? a.) helix-loop-helix b.) zinc fingers c.) leucine zippers d.) CpG islands Which of the following are correct regarding enhancers? a.) Enhancers may be located a great distance from the initiation site they regulate. b.) Enhancers can be either upstream or downstream from the initiation site. c.) Enhancers directly bind DNA and prevent binding of activators to the DNA. d.) Enhancers may function in either orientation (forward or backward).
The DNA-binding domain of each CREB protein subunit recognizes the sequence 5′–TGACGTCA–3′. Due to random chance, how often would you expect this sequence to occur in the human genome, which contains approximately 3 billion base pairs? Actually, only a few doze genes are activated by the CREB protein. Does the value of a few dozen agree with the number of random occurrences expected in the human genome? If the number of random occurrences of the sequence in the human genome is much higher than a few dozen, provide at least one explanation why the CREB protein is not activating more than a few dozen gene Actually, only a few doze genes are activated by the CREB protein. Does the value of a few dozen agree with the number of random occurrences expected in the human genome? If the number of random occurrences of the sequence in the human genome is much higher than a few dozen, provide at least one explanation why the CREB protein is not activating more than a few dozen gene
Assume the following DNA template strand: 3'-ATA GCG AGG AGT ATC-5' A) What would be the protein associated with this DNA template strand? Give the sequence of amino acids encoded by this fragment. Leave traces of your steps. B) In the synthesis of this protein, what are the codon and the anticodon for? Explain in one sentence for each. C) We find, in another cell, a mutation of this DNA template strand: 3' ATA GCG TGG AGT ATC-5’ 1. What type of point mutation is it? 2. Did this mutation arise during transcription, translation or DNA replication? D) If this mutation is found in a spermatozoon, will it have an effect on the individual, its offspring or both? Briefly explain
Describe the d=features of the following DNA-binding domains and how they interact with DNA. Helix-turn-Helix Zinc Finger Leucine Zipper Helix-loop-Helix
In the following sequence, a cytosine was deaminated and is now a uracil (underlined). 5’-GGTAUTAAGC-3’ a. Which repair pathway(s) could restore this uracil to cytosine? b. If the uracil is not removed before a DNA replication fork passes through, what will be the sequences of the two resulting double helices? Provide the sequences of both strands of both helices. Label the old and new strands and underline the mutation(s). c. Could the mismatch repair pathway fix the mutations you’ve indicated in part b? d. If the cell undergoes mitosis, and the replicated DNAs are distributed into the two daughter cells. Will 0, 1, or 2 daughter cells have a mutation in this sequence?
in the human gene for the beta chain of hemoglobin, the first 30 nucleotides in the amino acid coding region is represented by the sequence 3'TACCACGTGGACTGAGGACTCCTCTTCAGA-5'. What is the sequence of the partner strand? If the DNA duplex for the beta chain of hemoglobin above were transcribed from left to right, deduce the base sequence of the RNA in this coding region.
proteins can interact with DNA through relatively weak forces, such as hydrogen bonds and can der Waals interaction, as well as through stronger electrostatic interactions such as ion pairs. Which types of interaction predominate for sequence specifics DNA binding proteins and for sequence independent binding proteins?
Identify the type of point mutation on the following strands (transition or transversion): a. 5’ TACTGCA 3’ 5’ TATTGCA 3’ 3’ ATGACGT 5’ 3’ ATAACGT 5’ b. 5’ CGACGTTA 3’ 5’ CGAGGTTA 3’ 3’ GCTGCAAT 5’ 3’ GCTCCAAT 5’c. Which of these types is more common and why?
Which of the following set(s) of primers a–d couldyou use to amplify the following target DNA sequence, which is part of the last protein-coding exonof the CFTR gene?5′ GGCTAAGATCTGAATTTTCCGAG ... TTGGGCAATAATGTAGCGCCTT 3′3′ CCGATTCTAGACTTAAAAGGCTC ... AACCCGTTATTACATCGCGGAA 5′a. 5′ GGAAAATTCAGATCTTAG 3′;5′ TGGGCAATAATGTAGCGC 3′b. 5′ GCTAAGATCTGAATTTTC 3′;3′ ACCCGTTATTACATCGCG 5′c. 3′ GATTCTAGACTTAAAGGC 5′;3′ ACCCGTTATTACATCGCG 5′d. 5′ GCTAAGATCTGAATTTTC 3′;5′ TGGGCAATAATGTAGCGC 3′
A closed circular duplex DNA has a 100-bp segment of alternating C and G residues. On transfer to a high salt solution, the segment undergoes a transition from the B conformation to the Z conformation. What is the change in its linking number, writhing number, and twist?