How would the deletion of the following sequences or features most likely affect a eukaryotic pre-mRNA? Q. AAUAAA consensus sequence

Q: In this MRNA sequence, what reading frame is the START CODON (AUG) in? ACGGAUGCACGUACGU Select one:…

A: Reading frames are the division of DNA or RNA sequences in a set of non-overlapping sets of…

Q: How would the deletion of the following sequences or features most likely affect a eukaryotic…

A: Pre-mRNA or precursor mRNA is a type of primary transcript, which becomes the matured messenger RNA…

Q: of hnRNA into mature mRNA incl

A: hnRNA can be defined as heterogeneous nuclear RNA. It also refers to the large pre‐mRNAs consisting…

Q: Which of the following is not a possible size (in bp) of the mature mRNA? a. 205bp b. 180bp c. 150bp…

A: Need to find the mature mRNA in above options

Q: Which of the following types of RNA is involved in pre-mRNA splicing?

A: For eukaryotic genes and some prokaryotic genes, the initial RNA which is transcribed from a genes…

Q: Processing of primary mRNA transcripts in eukaryotic cells DOES NOT involve which of the following?…

A: Ans:-C 1.What end does the poly A tail attach to? 3′ end A poly (A) tail is added to the 3′ end of…

Q: What is the predicted size of the corresponding mature mRNA in base pairs (bp), excluding the 5’ cap…

A: The predicted size of the corresponding mature mRNA in base pairs (bp), excluding the 5’ cap and 3’…

Q: Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom:…

A: Deoxyribonucleic acid (DNA) is a double-stranded, a self-replicating material that is present in…

Q: The insertion of a base in a coding sequence leads to a shift in the reading frame, which in most…

A: A frameshift mutation in the process, in which the addition of the bases in the nucleotide sequence,…

Q: The following DNA nucleotides are found near the end of a bacterial transcription unit.…

A: Introduction Gene expression can only occur when the Gene is transcribed into mRNA and then this…

Q: The synthesis of multiple different protein isoforms from just one gene in eukaryotic cells would…

A: DNA( deoxyribonucleic acid) is the double-stranded molecule that is the genetic material in most…

Q: Draw a line between the codons for each strand of MRNA: 1. AGGUCAUGCAUGGGCAUGCAU 2.…

A: BASIC INFORMATION  GENETIC CODE  These are the codes which helps in the formation of the protein…

Q: How would the deletion of the following sequences or features most likely affect a eukaryotic…

A: The process of addition of poly adenylate tail to a messenger RNA is known as Polyadenylation. The…

Q: Describe in discrete steps how a polyadenylation signal contributes to the formation of a mature…

A: Answer: Introduction: Eukaryotic cellular process is regulated in the transcription process and RNA…

Q: ATG is the start codon for translating proteins into mRNA and nascent polypeptides are translated…

A:

Q: Which of the following is not something commonly associated with eukaryotic MRNAS? 1. Splicing of…

A: Messenger Ribonucleic acid [m-RNA] is formed inside the cell by the process of transcription. The…

Q: How many open reading frames are present in the following mRNA sequence? You may find the codon…

A: An open reading frame in molecular genetics describes the part of your reading frame that has the…

Q: Draw a typical eukaryotic gene and the pre-mRNA and mRNA derived from it. Assume that the gene…

A: Introduction A genome is consists of transcriptionally active genes. These genes form mRNA as they…

Q: Which of the following is/are typically removed from pre-mRNA during nuclear processing in…

A: The various steps that are generally observed during processing of pre-mRNA are- Addition of a 5'…

Q: 5. What is the correct reading frame for the following mRNA? MRNA 5' GGCACUUAUGCGAUGCCUUGAGUGACCAU…

A: mRNA is made from DNA by the process of Transcription.

Q: Name and describe three types of modification that the mRNA undergoes in eukaryotes before the MRNA…

A:

Q: A eukaryotic cell carrying out transcription and RNA processing is incubated with 32P-labeled ATP.…

A: Introduction: The process in which RNA is synthesized from DNA is known as transcription. Therefore,…

Q: Could two mRNAs have different nucleotide sequences and yet code for the same protein?

A: To synthesize protein molecules, a cell must first transfer information from DNA to mRNA through the…

Q: Which of the following processing events occur during or after the synthesls of MRNA molecules in…

A: Transcription  It is the process of makin copy of RNA from DNA. This RNA is known as messenger RNA

Q: How would the deletion of the following sequences or features most likely affect a eukaryotic…

A: Pre-mRNA or precursor mRNA is a type of primary transcript, which becomes the matured messenger RNA…

Q: When a eukaryotic gene is cut out of genomic DNA, geneticists have discovered that enabling the…

A: A gene is sequence of DNA, which codes for an mRNA through transcription. During the replication…

Q: Translate the mRNA sequence of HBs mRNA 5'- AUG GUG CAC CUG ACU CCU GUG GAG AAG UCU GCC GUU ACU…

A: Translation Process by which the mRNA codes for a particular protein is known as translation.

Q: Draw a typical eukaryotic gene and the pre-mRNA and mRNA derived from it. Assume that the gene…

A: The typical eukaryotic gene consists of an exon, intron, promoter sequence, a terminator sequence,…

Q: Draw a pre-mRNA with at least 4 exons and 3 introns and draw two possible mature mRNAs that can…

A: Answer: Central dogma  replication----> transcription -------> translational  DNA-------->…

Q: The following DNA nucleotides are found near the end of a bacterial transcription unit.…

A: Transcription is the process by which the information in a strand of DNA is copied into a molecule…

Q: Assuming that it is exactly and only 5 nucleotides long, write the Shine-Dalgarno sequence in the…

A: Given: The shine- dalgano sequence is a ribosomal binding site that is found in bacterial and…

Q: After the intron (which is in a lariat configuration) is released during pre-mRNA splicing, a brief…

A: In eukaryotes, the process of transcription and translation takes place in separate compartments.…

Q: In RNA silencing, siRNAs and miRNAs usually bind to which part of the mRNA molecules that they…

A: Small interfering RNAs or siRNAs and micro RNAs or miRNAs are those RNA segments that don't code for…

Q: What type of the mRNA is recognized as a first step of translation initiation in eukaryotes? a TaTA…

A: Translation is the process that results in protein synthesis. It takes place in the cytoplasm. This…

Q: Q. Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom:…

A: Since you have posted a question with multiple sub-parts, we will solve first three sub- parts for…

Q: Draw a typical eukaryotic gene and the pre-mRNA and mRNA derived from it. Assume that the gene…

A: The typical eukaryotic gene consists of an exon, intron, promoter sequence, a terminator sequence,…

Q: Which of the following precautions are NOT taken to stabilize mRNA? Polyadenylation at the 5'-end. O…

A: Eukaryotic transcription and translation occur at the different places. Transcription occurs at…

Q: Draw a eukaryotic mRNA that has been fully processed. Label the key parts including the Kozak…

A: The eukaryotic RNA is formed from the eukaryotic DNA by the process of transcription.

Q: A sequence in the upstream leader of an mRNA that helps in identification of the start site of the…

A: Start codon is the first codon of a messenger RNA .Start codon generally codes for methionine in…

Q: If an antisense RNA is designed to silence the following mRNA sequence, which of the following…

A: mRNA sequence:-5' UAGGACUAUUAAGGUACACCCAUU 3' to silence this sequence the antisense RNA should be…

Q: Below is a representation of a pre-mRNA.  Numbers represent exons, and letters represent introns:…

A: Transcription is a process through which the doucle stranded DNA transcribes itself into a single…

Q: Name the process in which unwanted mRNA regions are removed & wanted regions are joined.

A: Transcription is a process in which the DNA template is synthesized into mRNA. At the end of…

Q: Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom:…

A: DNA consists of two intertwined polynucleotide strands: coding strand and template strand. The…

Q: During the initiation of translation in bacteria, the small ribosomal subunit binds to which…

A: Translation occurs after the transcription in which genetic information is copied from DNA to RNA.…

Q: Of the following, which is a modification made to the pre-mRNA of eukaryotes before translation?…

A: According to the central dogma the genetic information stored in the form of DNA is first converted…

Q: yotic RNAS differ in which of the following ways? FRNA molecules are only part of the prokaryotic…

A: The prokaryotic and eukaryotic RNAs differ in these ways.

Q: Discuss the advantages, in terms of protein structure and evolution, that result from alternative…

A: Alternate splicing allows a single gene to code for multiple proteins. The protein translated from…

Q: Draw a typical eukaryotic gene and the pre-mRNA and mRNA derived from it. Assume that the gene…

A: Eukaryotic gene is defined as the DNA regions which will act as a template for the formation of RNA…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.