How would the deletion of the following sequences or features most likely affect a eukaryotic pre-mRNA? Q. Poly(A) tail

Q: In this MRNA sequence, what reading frame is the START CODON (AUG) in? ACGGAUGCACGUACGU Select one:…

A: Reading frames are the division of DNA or RNA sequences in a set of non-overlapping sets of…

Q: How would the deletion of the following sequences or features most likely affect a eukaryotic…

A: Pre-mRNA or precursor mRNA is a type of primary transcript, which becomes the matured messenger RNA…

Q: Which of the following is not a possible size (in bp) of the mature mRNA? a. 205bp b. 180bp c. 150bp…

A: Need to find the mature mRNA in above options

Q: What is the predicted size of the corresponding mature mRNA in base pairs (bp), excluding the 5’ cap…

A: The predicted size of the corresponding mature mRNA in base pairs (bp), excluding the 5’ cap and 3’…

Q: Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom:…

A: Deoxyribonucleic acid (DNA) is a double-stranded, a self-replicating material that is present in…

Q: The insertion of a base in a coding sequence leads to a shift in the reading frame, which in most…

A: A frameshift mutation in the process, in which the addition of the bases in the nucleotide sequence,…

Q: the translate on the mRNA in 5'AAA-AAA-AAA-AAA-AAA3' is?

A: Introduction :- In molecular biology , different processes of gene expression is studied , these…

Q: if a protein that contain the two codon sequences showed a molar mass of 97,313 g /mol and the UV…

A: The molecular weight of a Protein can be accurately predicted if the amino acids making up the…

Q: The base sequence of the gene coding for a short polypeptide is 5’CTACGCTAGGCGATTGATCATC’3.  What…

A: The process of formation of mRNA from template DNA sequence is known as transcription. The process…

Q: Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom: 5’-…

A: DNA and RNA are are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid…

Q: Draw a line between the codons for each strand of MRNA: 1. AGGUCAUGCAUGGGCAUGCAU 2.…

A: BASIC INFORMATION  GENETIC CODE  These are the codes which helps in the formation of the protein…

Q: The earliest work on the genetic code established UUU, CCC, and AAA as the codons for Phe, Pro, and…

A: The genetic code can be defined as a set of rules. The information is encoded in the genetic…

Q: List three molecular changes that take place in the processing of eukaryotic mRNA.

A: Eukaryotic mRNA goes through several changes before translating into protein. This s done to ensure…

Q: Which of the following is/are typically removed from pre-mRNA during nuclear processing in…

A: The various steps that are generally observed during processing of pre-mRNA are- Addition of a 5'…

Q: of mRNA that contains a total of 66 codons. What is the maximum number of amino acids that could be…

A: The formation of mRNA from DNA is called transcription and from mRNA to a protein called…

Q: How does a eukaryotic ribosome select its start codon? Describe the sequences in eukaryotic mRNAs…

A: The biological mechanism by which messenger RNA is translated into proteins in eukaryotes is known…

Q: Geneticists have found that when they cut out a eukaryotic gene from genomic DNA that they can…

A: Splicing  The removal of introns (non coding part of gene) from pre mature RNA.

Q: Know the name of the RNA molecule that is the initial product of the transcription of a eukaryotic…

A:

Q: Could two mRNAs have different nucleotide sequences and yet code for the same protein?

A: To synthesize protein molecules, a cell must first transfer information from DNA to mRNA through the…

Q: How would the deletion of the following sequences or features most likely affect a eukaryotic…

A: Precursor messenger ribonucleic acid (pre-mRNA) is a type of primary transcript. It is transcribed…

Q: Explain how eukaryotic mRNAs are modified to have a cap and a tail.

A: Biomolecules are the compounds that are necessary for different biological processes occurring in a…

Q: Geneticists have found that when they cut out a eukaryotic gene from genomic DNA that they can…

A: Alternative splicing is a process that enables a messenger RNA to direct the synthesis of different…

Q: How would the deletion of the following sequences or features most likely affect a eukaryotic…

A: Pre-mRNA or precursor mRNA is a type of primary transcript, which becomes the matured messenger RNA…

Q: How many possible mRNAs could be derived from a gene with three exons (exon 1, exon 2, and exon 3)?…

A: Transcription is a process in which one strand of DNA known as template strand is known as converted…

Q: What are two advantages for circularizing the mRNA during the process of eukaryotic translation?…

A: Thank you for the question  Answer The two advantages for circularizing the mRNA during the process…

Q: Draw a pre-mRNA with at least 4 exons and 3 introns and draw two possible mature mRNAs that can…

A: Answer: Central dogma  replication----> transcription -------> translational  DNA-------->…

Q: When scientists cut a eukaryotic gene from genomic DNA, they discovered that enabling the strands to…

A: Alternative splicing is a method through which a messenger RNA may control the creation of many…

Q: Could two mRNAs have different nucleotide sequences and yet code for the same protein? Explain.

A: mRNA brings information from the DNA for the formation of particular type of polypeptide. Therefore,…

Q: The base sequence of the gene coding for a short polypeptide is TAC CTA CGC TAG GCG ATT GAC T. What…

A: The process of making a copy of genetic information stored in a DNA strand to a complementary strand…

Q: How RNA processing adds a tail to the 3′ end of eukaryotic mRNAs?

A: Transcription is a process by which DNA sequences are copied by an enzyme called RNA polymerase to…

Q: How would the deletion of the Shine–Dalgarno sequence affect a bacterial mRNA?

A: A ribosomal binding site is a sequence of nucleotides upstream of the start codon of an mRNA…

Q: How many different polypeptides can be producedthrough alternative splicing of the same pre-mRNA?

A: Maturation of eukaryotic mRNA often entails the removal of RNA sequences (introns or intervening…

Q: Refer to the DNA sequence provided: 3’ -TACTGAAGCGGCAGCCCCGCATGAGTAGACCTTACT-5’ b. What is the…

A: Introduction Deoxyribonucleic acid (DNA) is a polymer made up of two polynucleotide chains that coil…

Q: Compare bacterial and eukaryotic mRNAs, and explain the functional significance of their structural…

A: Messenger RNAs (mRNA) are the carriers of genetic information from DNA to proteins. The information…

Q: Here is the sequence of a portion of a bacterial gene. The template strand is on the bottom:…

A: DNA and RNA are nucleic acids present in the organisms. DNA is the deoxy ribose nucleic acid whereas…

Q: explain which sequences within the pre-mRNA determine where splicing occurs? How? Why?

A: Splicing of a pre-mRNA molecule occurs in several steps that are catalyzed by small nuclear…

Q: A portion of an mRNA attached to a ribosome reads:   5′ GACAUGAACAGC 3′ If a tRNA with a…

A: The anticodon of the tRNA is 3'-UAC-5', and it binds to a codon in an mRNA with the sequence…

Q: We have a eukaryotic full-length mRNA molecule consisting of 33 bp 5ʹ -...…

A: The mRNA (messenger ribonucleic acid) is a messenger molecule produced through the process of…

Q: In eukaryotes, why is the initial RNA transcript usually longer than the mature mRNA molecule?…

A: Transcription is the process by which messenger rna is made from DNA.  This process takes place…

Q: what is the difference between leader mRNA and attenuator sequence? Please explain the function of…

A: Operon is a genetic regulatory system found in bacteria and their viruses in which genes coding for…

Q: Draw a typical eukaryotic gene and the pre-mRNA and mRNA derived from it. Assume that the gene…

A: The typical eukaryotic gene consists of an exon, intron, promoter sequence, a terminator sequence,…

Q: What polypeptide product would you expect from apoly-G mRNA that is 30 nucleotides long?

A: Introduction:- The mRNA is composed of nucleotides .A series of 3 bases is a codon.Each codon codes…

Q: Here is a schematic map with a scale of a eukaryotic gene. How long is the primary mRNA transcript…

A: The mRNA is produced by the process of transcription.

Q: Identify the different regions of the mature mRNA by matching terms with regions. A В AUG UGA сар…

A: Mature mRNA or mature transcript is the RNA present in eukaryotes  which consists of exons with all…

Q: A synthetic mRNA added to a cell-free protein-synthesizing system produces a peptide with the…

A: The amino acids are the building blocks of the protein; the amino acids are the small molecules that…

Q: Consider the wobble rules listed in Table 15.2. Which of the following mRNA codons will bind to the…

A: Protein translation is the process of molecular biology in which the mRNA synthesized by the process…

Q: Which of the following is likely associated with the mRNA processing step of alternative splicing?

A: A process that helps a single gene to code for many proteins is known as alternate splicing. It is…

Q: Consider the following portion of mRNA: 3'-CUU-AAA-CGA-GUU-5' What is the primary amino acid…

A: mRNA(messenger RNA) carries the genetic information copied from DNA in the form of a series of…

Q: Draw a typical eukaryotic gene and the pre-mRNA and mRNA derived from it. Assume that the gene…

A: Eukaryotic gene is defined as the DNA regions which will act as a template for the formation of RNA…

Q: Bacteria use the same stop codons as eukaryotes.  However, bacterial transcription is also…

A: The central dogma of molecular biology was given by Crick to explain the flow of genetic information…

Gene Interactions

When the expression of a single trait is influenced by two or more different non-allelic genes, it is termed as genetic interaction. According to Mendel's law of inheritance, each gene functions in its own way and does not depend on the function of another gene, i.e., a single gene controls each of seven characteristics considered, but the complex contribution of many different genes determine many traits of an organism.

Gene Expression

Gene expression is a process by which the instructions present in deoxyribonucleic acid (DNA) are converted into useful molecules such as proteins, and functional messenger ribonucleic (mRNA) molecules in the case of non-protein-coding genes.