Describe in discrete steps how a polyadenylation signal contributes to the formation of a mature mRNA with a poly A tail of more than 300 nucleotides long
Q: Which of the following statements are true about eukaryotic mRNA?a. The sigma factor is essential…
A: Proteins within the human body are made up of a small chain of building blocks, which are termed as…
Q: Derive the amino acid sequence that is coded for by the following mRNA sequence. 5' CAU AAA ACG GUG…
A: During the translation, the information present in the mRNA sequence results in the formation of…
Q: Explain why RISC binds to a specific mRNA. What type of bonding occurs?
A: The gene expression regulation in a cell to inhibit the expression of particular genes is called…
Q: In this MRNA sequence, what reading frame is the START CODON (AUG) in? ACGGAUGCACGUACGU Select one:…
A: Reading frames are the division of DNA or RNA sequences in a set of non-overlapping sets of…
Q: of hnRNA into mature mRNA incl
A: hnRNA can be defined as heterogeneous nuclear RNA. It also refers to the large pre‐mRNAs consisting…
Q: Which of the following is not a possible size (in bp) of the mature mRNA? a. 205bp b. 180bp c. 150bp…
A: Need to find the mature mRNA in above options
Q: During MRNA splicing... intron-exon boundaries are marked by exon junction complexes. the 5' cap and…
A: mRNA splicing is a process in which a newly-made precursor mRNA transcript gets converted into a…
Q: Describe the sequence in bacterial mRNA that promotes recognition by the 30S subunit.
A: RNA or ribonucleic acid is a polymer of ribonucleotides connected together via a phosphodiester…
Q: Describe the process of transcription of mrna in an eukaryotes cell.
A: Gene expression is a process by which the genes are turned on to form RNA and proteins. This is seen…
Q: Draw a general structure of a mature mRNA
A: mRNA is a single-stranded RNA that contains a genetic sequence and it encodes for a protein. It is…
Q: What is the predicted size of the corresponding mature mRNA in base pairs (bp), excluding the 5’ cap…
A: The predicted size of the corresponding mature mRNA in base pairs (bp), excluding the 5’ cap and 3’…
Q: Write the functions of UTR of mRNA
A: Transcription is the process in which single-stranded RNA molecules are produced by RNA polymerases.…
Q: How would the deletion of the following sequences or features most likely affect a eukaryotic…
A: The process of addition of poly adenylate tail to a messenger RNA is known as Polyadenylation. The…
Q: The anticodon loop of the first tRNA that will complement this MRNA is Select one: O a. 5'-ACG-3' O…
A: Messenger RNA (mRNA): mRNA is a single-stranded RNA molecule that is complementary to one of the DNA…
Q: Draw a typical eukaryotic gene and the pre-mRNA and mRNA derived from it. Assume that the gene…
A: Introduction A genome is consists of transcriptionally active genes. These genes form mRNA as they…
Q: For each of the 3 processes below, ... .Fill in list of terms needed (choose terms from the "List of…
A: Transcription is a process of formation of transcript or RNA from DNA by the process of…
Q: Which of the following is/are typically removed from pre-mRNA during nuclear processing in…
A: The various steps that are generally observed during processing of pre-mRNA are- Addition of a 5'…
Q: Compare and contrast the formation of mRNA in bacterial and eukaryotic cells. How do the differences…
A: Gene expression is a process by which the genes are turned on to form RNA and proteins. This is seen…
Q: mutant appear on a gel in comparison
A: Point mutations can cause serious changes to an organism if they change the way a protein works By…
Q: Which of the following is TRUE about MRNA splicing? O a. Splicing occurs after complete mRNA is…
A:
Q: Name and describe three types of modification that the mRNA undergoes in eukaryotes before the MRNA…
A:
Q: The base sequence of the gene coding for a short polypeptide is 5’CTACGCTAGGCGATTGATCATC’3. a) What…
A: According to the central dogma, the information flows From DNA to proteins. DNA is transcribes into…
Q: In eukaryotes, the mRNA is usually smaller than the gene, this is due to a. splicing b.…
A: Messenger RNA (mRNA) is a molecule found in cells that transports information from DNA in the…
Q: Using what is known about the location of introns, a methylguanosine cap, and a poly-A tail, the…
A: Answer. In eukaryotes, transcription, and translation take place in different compartments of…
Q: Identify some of the types of regulatory controls that operate in eukaryotes after mature mRNA is…
A: Gene expression in eukaryotes is regulated at several levels.
Q: Draw a pre-mRNA with at least 4 exons and 3 introns and draw two possible mature mRNAs that can…
A: Answer: Central dogma replication----> transcription -------> translational DNA-------->…
Q: differential lengths of poly-A tails affect mRNA stability identify which describes the statement…
A: mRNA needs to undergo certain modifications in order for it to be active for translation process.…
Q: b) How does accuracy of aminoacylation during tRNA charging regulated to ensure fidelity of genetic…
A: Answer. The fidelity of protein synthesis depends on the accuracy of the two mechanisms: The linking…
Q: Describe the significance of a 5 cap poly A tail on the mature mRNA
A: mRNA- is a coding sequence of a gene implicated in the synthesis of protein, approximately, 4% of…
Q: discuss how pre mRNA is formed in the nucleus and the RNA processing that happen to form a matured…
A: When an RNA transcript is first made in a eukaryotic cellular, it's far taken into consideration a…
Q: the processing of pre-mRNA in eukaryotes Select one: a. Exons are joined together using…
A: In Prokaryotes; both Transcription and translation process takes place in the cytoplasm; but in…
Q: Mhich of the following polypeptides is coded for my the MRNA sequence 5' AUGGUUAAACGACAAUCC 3 ?
A: The amino acids are selected and wrote in the sequence as first, second and third base. The process…
Q: What is the mechanism for addition of a guanosine to create the 5' methyl cap of a MRNA? O The 5'-OH…
A: Mature mRNA is an mRNA that is modified post-transcriptionally. Mature mRNA carries information from…
Q: Which of the following precautions are NOT taken to stabilize mRNA? Polyadenylation at the 5'-end. O…
A: Eukaryotic transcription and translation occur at the different places. Transcription occurs at…
Q: RNA silencing can be accomplished by specific MRNA degradation or by preventing its translation of…
A: RNA-induced transcriptional silencing (RITS) is a form of RNA interference by which short RNA…
Q: ist the three ways in which eukaryotic mRNA is modified.
A: Messenger RNA (mRNA) is defined as a single-stranded RNA molecule that will correspond to a specific…
Q: a) What is the region of the MRNA with all of the X's in this image called?
A: Translation is the process of formation of amino acid sequence using messenger RNA as a template and…
Q: Identify the different regions of the mature mRNA by matching terms with regions. A В AUG UGA сар…
A: Mature mRNA or mature transcript is the RNA present in eukaryotes which consists of exons with all…
Q: Alternative splicing allows for more proteins to be made from the same region of DNA; explain how…
A: Alternative splicing is a process in which more than one mRNA can be made from the same gene.
Q: a) What is a mutation in molecular terms? b) a mutation deletes a base in the genomic DNA…
A: Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: Name the process in which unwanted mRNA regions are removed & wanted regions are joined.
A: Transcription is a process in which the DNA template is synthesized into mRNA. At the end of…
Q: Identify the different regions of the mature mRNA by matching terms with regions. regions are shown…
A: Answer. Eukaryotic m RNA are mostly monocistronic having an average size of 1500 to 2000…
Q: Provide one mechanism by which changes in mRNA levels are not always matched by changes in the…
A: Post-transcriptional regulation is the mechanisms by which cell prevents formation of any wrong…
Q: Discuss the advantages, in terms of protein structure and evolution, that result from alternative…
A: Alternate splicing allows a single gene to code for multiple proteins. The protein translated from…
Q: Draw a typical eukaryotic gene and the pre-mRNA and mRNA derived from it. Assume that the gene…
A: Eukaryotic gene is defined as the DNA regions which will act as a template for the formation of RNA…
Q: Describe how eukaryotic mRNA structure can affect translational control.
A: Answer- According to the central dogma the mRNA is synthesized by the DNA through the process of…
Describe in discrete steps how a polyadenylation signal contributes to the formation of a mature mRNA with a poly A tail of more than 300
Step by step
Solved in 2 steps
- Which of the following is/are typically removed from pre-mRNA during nuclear processing in eukaryotes? (a) upstream leader sequences (b) poly-A tail (c) introns (d) exons (e) all the precedingGiven the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:Consider the following mRNA base sequence 5' CUU CAG 3 a What dipeptide is coded for this mRNA? b. What dipeptide is formed if a point mutation converts CUU to CUC? c. What dipeptide is formed it a point mutation converts CAG to AAG?
- Describe the various post-transcriptional and post-translational modifications that occur during the transition from pre-mRNA to mature protein.Draw a pre-mRNA with at least 4 exons and 3 introns and draw two possible mature mRNAs that can result from alternative splicing of this RNA.There may be more than one answer for each Expression of mRNA can be regulated by which of the following? a.) RNA interference b.) presence of vectors c.) antisense RNA d.) blocking of poly(A)polymerase Which of the following occur during processing of pre-mRNA? a.) removal of exons b.) removal of noncoding sequences c.) addition of 5’ cap structure d.) addition of poly-A tail
- Identify the different regions of the mature mRNA by matching terms with regions. regions are shown in the second image terms: poly-A-tail 5'UTR 3'UTR coding sequenceWhat is the total size of the mature i.e. fully processed mRNA in nucleotides? How many amino acids would the encoded protein be? Assume that the N- terminal Met encoded by the AUG start codon, is NOT cleaved from the protein?As shown in the following diagram, a pre-mRNA contains seven exons, which are numbered in black, and six introns, which are numbered in green. A splicing repressor binds at the 3′ splice site at the end of intron 4, which is just before exon 5. What exons will be included in the mature mRNA?
