ATG is the start codon for translating proteins into mRNA and nascent polypeptides are translated with Methionine in the first position. Why do protein sequences not all begin with Methionine? O Alternative start codons Post translational modifications MRNA splicing removes the ATG O none of the above

ATG is the start codon for translating proteins into mRNA and nascent polypeptides are translated with Methionine in the first position. Why do protein sequences not all begin with Methionine? O Alternative start codons Post translational modifications MRNA splicing removes the ATG O none of the above

Biology (MindTap Course List)

11th Edition

ISBN:9781337392938

Author:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Publisher:Eldra Solomon, Charles Martin, Diana W. Martin, Linda R. Berg

Chapter13: Gene Expression

Section: Chapter Questions

Problem 8TYU: Which of the following is/are typically removed from pre-mRNA during nuclear processing in...

See similar textbooks

Similar questions

Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?
Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:
Below is the DNA sequence of a patient with overlapping genes (a single mRNA has multiple initiation points for translation) for two different proteins (DADαs and AMA): 5’- GTCCCAACCATGCCCACCGATCTTCCGCCTGCTTCTGAAGATGCGGGCCCAGGGAAATCTCTAACG-3’ 1. Indicate the DNA sequence coding for RNA. 2. Indicate the amino acid sequence of each of them.
If there are multiple start condo, how can you identify the real start codon? By observing Okazaki fragments By identifying splicing site Using sequence data bases By identifying Kozak sequence Which one is not a part of the transcription unit? RNA primase Promoter RNA coding sequence Terminator
The tRNA molecule carries EIF2 and GTP and binds the small ribosomal subunit at the P site in the first steps of translation initiation. tue or false
Which of the following is an intron and intergenic coded long transcripts, processed into stem and loop structures that may bind specifically or otherwise? a. spliceosome RNA b. LncRNA c. miRNA d. piRNA e. siRNA
Vaccina virus (used in the polio vaccine) produces an enzyme that takes the 5’ cap off of the mRNAs in the eukaryotic cells it infects. Besides allowing degradation of the host’s mRNA, what step in translation of the host’s mRNAs does this prevent? Group of answer choices Movement of tRNA from the A site to the P site tRNA binding to the A site Recognition of the stop codon Ribosome small subunit from binding mRNA Movement of the tRNA from the P site to the A site
Which one of the following options is NOT a step in RNA processing? Addition of the 5’ G cap Addition of the 3’ poly A tail Splicing to remove exons and connect the retained introns Splicing to remove introns and connect the retained exons
A scientist mutates eIF-2 to eliminate its GTP hydrolysis capability. How would this mutated form of eIF-2 alter translation? a. Initiation factors would not be able to bind to mRNA. b. The large ribosomal subunit would not be able to interact with mRNA transcripts. c. tRNAi-Met would not scan mRNA transcripts for the start codon. d. eIF-2 would not be able to interact with the small ribosomal subunit.
The primary RNA transcript of the chicken ovalbumin gene is 7700 nucleotides long, but the mature mRNA that is translated on the ribosome is 1872 nucleotides long. This size difference occurs primarily as a result of: capping cleavage of polycistronic mRNA removal of poly A tails reverse transcription splicing
All of these are mechanisms of eukaryotic RNA processing except: Group of answer choices The splicing of introns. The placing of a poly A tail. The placement of a 5' cap. The placement of a 3' cap.
Select all of the factors in the list below that play a role in the translation initiation of eukaryotic cells. the Kozak sequence eIF4G 3'-polyA tail fMet-tRNA the Shine-Dalgarno sequence eIF4E 5'-CAP PolyA Binding Protein (PABP)