Human Anatomy & Physiology (11th Edition)
Human Anatomy & Physiology (11th Edition)
11th Edition
ISBN: 9780134580999
Author: Elaine N. Marieb, Katja N. Hoehn
Publisher: PEARSON
Bartleby Related Questions Icon

Related questions

Q: The given figure shows the denaturation curves for three DNA samples. Move the labels to their…
A: Denaturation of DNA is a process of separating double-stranded DNA into single strands.During…
Q: 2. In purple people eaters, one horn (H) is dominant and no horns (h) is recessive. Complete the…
A: It is given that the one horn is dominant represented with H whereas no horn is recessive and…
Q: I am practicing discerning heriditary blood type questions. Please guide me with my first question.
A: The ABO classification is the most important and relevant for blood compatibility. A small number of…
Q: Calculate the allelic frequencies observed in the class for marker PV92. Is the class 'population'…
A: Key points: Microevolution is a change in the frequency of gene variants, alleles, in a…
Q: II The pedigree above tracks the presence of attached earlobes through a family's generation. Having…
A: As per our policy we are answering the only one question.  For the rest of the question kindly…
Q: 6. Look at the following pedigree for a given trait to answer the questions below. || 1 B A KEY: O I…
A: According to Bartleby guidelines, only the first three have been answered. Kindly post the remaining…
Q: My sincere apologies for not reading the honor code properly. Can I have an overview of how to…
A: Genetic linkage is explained as the closeness of genes on a chromosome (closely packed DNA molecule)…
Q: Can you please answer 32
A: Any alteration in the genome’s nucleotide sequence is called a mutation. It may involve small-scale…
Q: plz explain with thorough explanation
A: Here we provide the information regarding the inter distance of origin of replications.  Given data:…
Q: se #1: The Story of the Peppered Moth reat Britain, prior to the 1800s, most peppered moths had…
A: Evolution is the accumulation of different kinds of adaptations over a period of time which can give…
Q: I believe the answer would be A and D, but I am not sure because the recombinant proteins are…
A: In biochemistry, heterologous proteins are those proteins that are inserted and expressed in a…
Q: Koala bears AaBbCc were testcrossed. The results: Phenotype Number AbC 5 Abc 52 abC 373 abc 72 АВс…
A: Given:
Q: 8. Describe an "invalid," "faith birth". 9. Why does Vincent describe Jerome as "engineered with…
A: Introduction The film Gattaca examines issues related to selective reproduction, genetic…
Q: Match the genotype to the phenotype for the following traits. Y = yellow; y = green R= round; r =…
A: Introduction The genotype is the genetic material passed down through generations, while the…
Q: Name TWO functions of the 5'UTR.
A: Solution The 5' UTR plays important role in stability, processing and localisation of mRNA.  5' UTR…
Q: 5. Patients with palmoplantar keratoderma (PPK) have yellowish thickening of the skin on their hands…
A: Introduction :- A pedigree is a genetic representation of the inheritance of a trait or disease…
Q: 2. In order from left to right, to which groups do the chromosomes shown belong? O A. group A, group…
A: Chromosomes are present inside the cell nucleus and made up of DNA (Deoxyribonucleic acid) molecules…
Q: Mechanization of transportation has allowed mass movement of humans all around the globe in the past…
A: Globalization is a complex and multi-faceted set of processes that has a wide range of effects on…
Q: ity to straighten the little finger Hypercholesterolemia (the most common human Mendelian disorder)…
A: Cystic fibrosis is a genetic disorder that results in the buildup of thick mucus. It also leads to…
Q: Punnett Squares Complete the Punnett Square. Find probability of each phenotype in the offspring. Nn…
A: From the monohybrid cross, Mendel’s law of segregation was given. According to this law, when two…
Q: Gregor Mendel: CHECK ALL THAT APPLY conducted research that proved that the "blending hypothesis"…
A: Introduction Gregor Mendel:- He was an Austrian scientist, teacher, and Augustinian prelate who…
Q: Select the letter of the most appropriate answer.          -           A.           B.           C.…
A: Hello, thank you for your question. One section has 11 points and the other has 14 points. So if it…
Q: Science and Society: In 1966, Stanley Gartler presented his findings at an international conference-…
A: Introduction A genetic marker is a DNA sequence on a chromosome that has a known physical location.…
Q: Familial Down syndrome is similar to primary Down syndrome in that it is caused by trisomy 21.…
A: thank you please give a like    if there is any Non-loaded images in answer section, it will be…
Q: Hardy-Weinberg Practice Problems *Remember: p2 + 2pq+q2 = 1 and p + q = 1 *Remember: p2 = AA, 2pq =…
A: According to the Hardy-Weinberg principle, allele frequencies in a population are stable and remain…
Q: Purple flowers are dominant to white flowers. Identify the phenotype for the following genotype Ff,…
A: It is given that purple color is dominant over white color flower
Q: 1. Two normal-visioned parents produce a colour-blind son. What are the genotypes of the parents?…
A: As per our honor code, we are allowed to answer one question at a moment. You have posted multiple…
Q: 2. The following chart shows the crossover frequencies for genes on an autosome of the Armor Plated…
A: The crossing over frequency between two genes depict the genetic distance between two genes.
Q: The afflicted individuals in the pedigree have dysphasia-like condition. The gel below shows results…
A: A verbal disorder known as dysphasia or aphasia. It has an impact on how you speak and comprehend…
Q: Punnett Square
A: A Punnett square serves as a valuable instrument employed within the field of genetics to visualize…
bartleby

Concept explainers

Dissection
Dissection is the process of cutting up the tissue of a dead or live animal or plant, to do anatomical studies and surgical treatments. The purpose of dissection is to learn more about the overall structure of organs and organ systems and thereby underst…
Question

I need help finding the correct answers. the formula I used is % idenity=(length of the aligned region- the number of mismatches)/length of the aligned regionx100 

for sequnce `1 and 3 I got a 70 percent idenity and 3 mismatches I think I am counting the wrong mismatches
? 

can someone correct my answers and show me how they got theres and do not use chegg 

Your task is to test the null hypothesis that the application of fungicide has no effect on the bacterial community structure of the phyllosphere. Based on the data, you will either reject or not reject this hypothesis. Below is a subset of the sequence data provided to you. 1) TGTGTCTTACAGGGGGATAA 2) TGTGTCATATAGCGGGATAA 3) TGTGTCATATAGCGGGATAA 4) TGAGGGATAGAGGGGTATAA 5) TGCGTAATAAAGGGCGATAC 6) TGCGTAATAAAGGGCGATAT 7) TGAGAGATAGAGGGGTATAA 8) TGCGTAATAAAGGGCGATAT 9) TGAGCGATAGAGGGGCATAA 10) TGTGTCTTACAGGGGGATAA 1) These DNA sequences have been aligned already so it is easier for you to spot differences between them. In the table that follows, the a) number of mismatches and b) percentage identity were recorded for every pair of sequences, except for a few. Fill in these blanks (colored grey). sequence # 1 2 3 4 5 6 7 8 9 10 sequence # → 1 85 70 70 70 70 70 70 100 2 3 100 70 aka 70 || | 7| 85| 3 70 0 70 RRRRRS 4 65 70 70 65 95 70 70 95 65 70 70 6 6 6 85 2 5 6 6 70 65 95 6 6 7 7 1 6 6 65 70 70 65 65 70 7 6 6 6 1 7 7 65 90 70 8 6 6 ... 6 17 7 L 1 17 7 aluluk 9 6 6 ala 6 halda 1 +++ 7 2 65 70 70 10 0 7 6 Jalablabalala ++ 3 3 6 6 7 6 6 6 % identity number of mismatches
expand button
Transcribed Image Text:Your task is to test the null hypothesis that the application of fungicide has no effect on the bacterial community structure of the phyllosphere. Based on the data, you will either reject or not reject this hypothesis. Below is a subset of the sequence data provided to you. 1) TGTGTCTTACAGGGGGATAA 2) TGTGTCATATAGCGGGATAA 3) TGTGTCATATAGCGGGATAA 4) TGAGGGATAGAGGGGTATAA 5) TGCGTAATAAAGGGCGATAC 6) TGCGTAATAAAGGGCGATAT 7) TGAGAGATAGAGGGGTATAA 8) TGCGTAATAAAGGGCGATAT 9) TGAGCGATAGAGGGGCATAA 10) TGTGTCTTACAGGGGGATAA 1) These DNA sequences have been aligned already so it is easier for you to spot differences between them. In the table that follows, the a) number of mismatches and b) percentage identity were recorded for every pair of sequences, except for a few. Fill in these blanks (colored grey). sequence # 1 2 3 4 5 6 7 8 9 10 sequence # → 1 85 70 70 70 70 70 70 100 2 3 100 70 aka 70 || | 7| 85| 3 70 0 70 RRRRRS 4 65 70 70 65 95 70 70 95 65 70 70 6 6 6 85 2 5 6 6 70 65 95 6 6 7 7 1 6 6 65 70 70 65 65 70 7 6 6 6 1 7 7 65 90 70 8 6 6 ... 6 17 7 L 1 17 7 aluluk 9 6 6 ala 6 halda 1 +++ 7 2 65 70 70 10 0 7 6 Jalablabalala ++ 3 3 6 6 7 6 6 6 % identity number of mismatches
Expert Solution
Check Mark
This question has been solved!
Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.
See solutionCheck out a sample Q&A here
Step 1: Introduction:
VIEW
Step 2: Answer:
VIEW
Solution
VIEW
bartleby

Step by stepSolved in 3 steps with 4 images

See solution
Check out a sample Q&A here
Blurred answer
Knowledge Booster
Background pattern image
Biology
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
SEE MORE QUESTIONS
Recommended textbooks for you
Text book image
Human Anatomy & Physiology (11th Edition)
Biology
ISBN:9780134580999
Author:Elaine N. Marieb, Katja N. Hoehn
Publisher:PEARSON
Text book image
Biology 2e
Biology
ISBN:9781947172517
Author:Matthew Douglas, Jung Choi, Mary Ann Clark
Publisher:OpenStax
Text book image
Anatomy & Physiology
Biology
ISBN:9781259398629
Author:McKinley, Michael P., O'loughlin, Valerie Dean, Bidle, Theresa Stouter
Publisher:Mcgraw Hill Education,
Text book image
Molecular Biology of the Cell (Sixth Edition)
Biology
ISBN:9780815344322
Author:Bruce Alberts, Alexander D. Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter
Publisher:W. W. Norton & Company
Text book image
Laboratory Manual For Human Anatomy & Physiology
Biology
ISBN:9781260159363
Author:Martin, Terry R., Prentice-craver, Cynthia
Publisher:McGraw-Hill Publishing Co.
Text book image
Inquiry Into Life (16th Edition)
Biology
ISBN:9781260231700
Author:Sylvia S. Mader, Michael Windelspecht
Publisher:McGraw Hill Education
SEE MORE TEXTBOOKS