Homework Help is Here – Start Your Trial Now!
Science
Biology
I need help finding the correct answers. the formula I used is % idenity=(length of the aligned region- the number of mismatches)/length of the aligned regionx100  for sequnce `1 and 3 I got a 70 percent idenity and 3 mismatches I think I am counting the wrong mismatches ?

I need help finding the correct answers. the formula I used is % idenity=(length of the aligned region- the number of mismatches)/length of the aligned regionx100  for sequnce `1 and 3 I got a 70 percent idenity and 3 mismatches I think I am counting the wrong mismatches ?

Biology: The Dynamic Science (MindTap Course List)
Biology: The Dynamic Science (MindTap Course List)
4th Edition
ISBN:9781305389892
Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan
Chapter30: Fungi
Section: Chapter Questions
Problem 15TYK
See similar textbooks
icon
Related questions
Question

I need help finding the correct answers. the formula I used is % idenity=(length of the aligned region- the number of mismatches)/length of the aligned regionx100 

for sequnce `1 and 3 I got a 70 percent idenity and 3 mismatches I think I am counting the wrong mismatches
? 

can someone correct my answers and show me how they got theres and do not use chegg 

Your task is to test the null hypothesis that the application of fungicide has no effect on the bacterial community structure of the phyllosphere. Based on the data, you will either reject or not reject this hypothesis. Below is a subset of the sequence data provided to you. 1) TGTGTCTTACAGGGGGATAA 2) TGTGTCATATAGCGGGATAA 3) TGTGTCATATAGCGGGATAA 4) TGAGGGATAGAGGGGTATAA 5) TGCGTAATAAAGGGCGATAC 6) TGCGTAATAAAGGGCGATAT 7) TGAGAGATAGAGGGGTATAA 8) TGCGTAATAAAGGGCGATAT 9) TGAGCGATAGAGGGGCATAA 10) TGTGTCTTACAGGGGGATAA 1) These DNA sequences have been aligned already so it is easier for you to spot differences between them. In the table that follows, the a) number of mismatches and b) percentage identity were recorded for every pair of sequences, except for a few. Fill in these blanks (colored grey). sequence # 1 2 3 4 5 6 7 8 9 10 sequence # → 1 85 70 70 70 70 70 70 100 2 3 100 70 aka 70 || | 7| 85| 3 70 0 70 RRRRRS 4 65 70 70 65 95 70 70 95 65 70 70 6 6 6 85 2 5 6 6 70 65 95 6 6 7 7 1 6 6 65 70 70 65 65 70 7 6 6 6 1 7 7 65 90 70 8 6 6 ... 6 17 7 L 1 17 7 aluluk 9 6 6 ala 6 halda 1 +++ 7 2 65 70 70 10 0 7 6 Jalablabalala ++ 3 3 6 6 7 6 6 6 % identity number of mismatches
Transcribed Image Text:Your task is to test the null hypothesis that the application of fungicide has no effect on the bacterial community structure of the phyllosphere. Based on the data, you will either reject or not reject this hypothesis. Below is a subset of the sequence data provided to you. 1) TGTGTCTTACAGGGGGATAA 2) TGTGTCATATAGCGGGATAA 3) TGTGTCATATAGCGGGATAA 4) TGAGGGATAGAGGGGTATAA 5) TGCGTAATAAAGGGCGATAC 6) TGCGTAATAAAGGGCGATAT 7) TGAGAGATAGAGGGGTATAA 8) TGCGTAATAAAGGGCGATAT 9) TGAGCGATAGAGGGGCATAA 10) TGTGTCTTACAGGGGGATAA 1) These DNA sequences have been aligned already so it is easier for you to spot differences between them. In the table that follows, the a) number of mismatches and b) percentage identity were recorded for every pair of sequences, except for a few. Fill in these blanks (colored grey). sequence # 1 2 3 4 5 6 7 8 9 10 sequence # → 1 85 70 70 70 70 70 70 100 2 3 100 70 aka 70 || | 7| 85| 3 70 0 70 RRRRRS 4 65 70 70 65 95 70 70 95 65 70 70 6 6 6 85 2 5 6 6 70 65 95 6 6 7 7 1 6 6 65 70 70 65 65 70 7 6 6 6 1 7 7 65 90 70 8 6 6 ... 6 17 7 L 1 17 7 aluluk 9 6 6 ala 6 halda 1 +++ 7 2 65 70 70 10 0 7 6 Jalablabalala ++ 3 3 6 6 7 6 6 6 % identity number of mismatches
Expert Solution
steps

Step by step

Solved in 3 steps with 4 images

SEE SOLUTIONCheck out a sample Q&A here
Blurred answer
Knowledge Booster
Dissection
Learn more about
Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.
Similar questions
  • SEE MORE QUESTIONS
Recommended textbooks for you
Biology: The Dynamic Science (MindTap Course List)
Biology: The Dynamic Science (MindTap Course List)
Biology
ISBN:
9781305389892
Author:
Peter J. Russell, Paul E. Hertz, Beverly McMillan
Publisher:
Cengage Learning
SEE MORE TEXTBOOKS