Answered: If a person os homozygous for the…

If a person os homozygous for the presence of an ALU repeat in the PV92 region you would expect the size of the DNA fragment to be compared to those whith no ALUrepeats

Biology: The Unity and Diversity of Life (MindTap Course List)

15th Edition

ISBN:9781337408332

Author:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Publisher:Cecie Starr, Ralph Taggart, Christine Evers, Lisa Starr

Chapter15: Studying And Manipulating Genomes

Section: Chapter Questions

Problem 5SQ: A set of cells that host various DNA fragments collectively representing an organisms entire set of...

See similar textbooks

Related questions

Q: The technique of dideoxy sequencing of DNA is described inChapter 20. The technique relies on the…

A: Introduction DNA is composed of the nucleotides arranged in a specific sequence. Prior knowledge of…

Q: If this is the original sequençe of a DNA strand: CCAGGTCCATGACTTAGC, how would you labeled the one…

A: It is an alteration in the nucleotide sequence of the genome of an organism.

Q: Cargaff rules tells us if we know the amount of one nucleobase for an orgnaiss DNA, we can deterine…

A: Chargaff's rule states that DNA in any organism consists of an equal amount of purines and…

Q: Double-helical DNA has major and minor grooves because

A: The question is regarding DNA double helix structure. The structure of a DNA molecule is described…

Q: The palm domain of a DNA polymerase O contains the catalytic site of the enzyme Ograbs the incoming…

A: The majority of organisms' genetic material, deoxy ribonucleic acid (DNA), contains nucleotide…

Q: ou are given a segment of DNA : 5’ - CATGTCAAC – 3’ What is the complimentary strand?

A: Adenine in DNA always pairs with Thymine and cytosine always pairs with Guanine and vice versa .…

Q: Given the DNA strand with sequence 5' AUGGAGGAUGGCCAGUCAAUUUGA 3' match the various mutations to the…

A: Codon is a sequence of three nucleotides that corresponds to a specific amino acid. Codons encode…

Q: Scientific Inquiry Suppose you are a research assistant ina lab studying DNA-binding proteins. You…

A: Deoxyribonucleic acid (DNA) is a genetic material comprising thousands of genes condensed in form…

Q: . SCIENTIFIC INQUIRY The scientists mapping the SNPs inthe human genome noticed that groups of SNPs…

A: Single nucleotide polymorphisms, frequently called SNPs (pronounced "snips"), are the most common…

Q: Genskap/Property A-DNA B-DNA Z-DNA Algehele proporsies/Overall Kort en 1.3.1 Verleng en proportions…

A: The Watson-Crick double-helical model explains the features of the B form of the DNA. There are many…

Q: Please explain it simply, and don't over-explain. Thanks!

A: DNA is a genetic material that regulate all functions and character of our body. It condensed to…

Q: Cells have only one fundamental wayof replicating DNA but many differentways of repairing it. Are…

A: DNA is the genetic material present in the cells of living beings.

Q: Describe the double-stranded structure of DNA, and explainhow the AT/GC rule underlies the ability…

A: the double-stranded structure of DNA is genetic material

Q: /hich of the following statemer ue about DNA polymerase: DNA polymerase can synthesiz- MRNA in the…

A: DNA polymerase (DNAP) is an enzyme that makes new copies of DNA in the form of nucleic acid…

Q: The cells of many eukaryotic organisms have highly specialized systems that specifically repair G–T…

A: Introduction Repair mechanisms exist to maintain genome integrity and stability in organisms. The…

Q: 9. You have two tubes, each containing a different DNA fragment. The fragments are the same…

A: Restriction enzymes are those which cut DNA at a specific location called as restriction site.

Q: An alien organism was investigated. When DNA replicationwas studied, a unique feature was apparent:…

A: DNA (Deoxy Ribonucleic Acid) is the genetic element in all the prokaryotes and eukaryotic cells. DNA…

Q: Telomeres enable DNA polymerase to synthesize new DNA at the tips of the 5' ends of eukaryotic DNA.…

Q: EcoRI Sacl Kpnl Aval ampR Xmal Smal lacZ BamHI Xbal Sall Accl HinclI Pstl Sphl HindIII Bam H1 Bam H1…

A: Answer :- Option (C) is correct. - 1. :-

Q: The 50ul of your restriction digest contains 500ng of DNA how much DNA (ng) are you loading into the…

A: DNA yield (µg) = DNA concentration × total sample volume (ml) Usually we need : Restriction…

Q: Suppose you are a research assistant ina lab studying DNA-binding proteins. You have been giventhe…

A: amino acids can be neutral, positively or negatively charged. this is due to the number to charged…

Q: Below are two sequences of a segment of DNA. Normal sequence TAG GTC CÁC Mutated sequence TAG GTC…

A: TRANSVERSION In this mutation involving a transversion i.e. a purine is substituted for a pyrimidine…

Q: Segment of DNA SGCTAACCTGATCGCCGGTATT 3'CGATTGGACTAGCGGCCATAAS 3' 1. Transcribe and translate the…

A: The change in nucleotide is called a mutation. it could be a point mutation when one nucleotide is…

Q: Describe the genetic roles of DNA helicase and DNA polymerase. Contrast the function of DNA…

A: Helicases are enzymes that bind to nucleic acid or nucleic acid protein complexes and can even…

Q: which type of base pairs uf any allow the dna to remain double dtranded at higher temperature? gc…

A: DNA is the main store house of genetic information in our body. DNA condensed to form chromosome,…

Q: Shown are several single stranded DNA sequences written in the 5' to 3' direction. Which of the…

A: A hair pin structure will be formed due to internal base pairing in a DNA molecule.

Q: In human DNA, 80% of in sequences are methylated.A. adenines, ApTB. thymines, ApTC. cytosines, CpGD.…

A: Deoxyribonucleic acid (DNA) methylation is a biological process in which methyl groups are added to…

Q: . DNA polymerase requires both a template, to be copied, and a primer, which provides a 3' hydroxyl…

A: The process of DNA synthesis occurs in all of the living organisms and serves as a base for…

Q: Two particular contigs are suspected to be adjacent, possibly separated by repetitive DNA. In an…

A: Introduction Deoxyribonucleic acid (DNA) is a polymer made up of two polynucleotide chains that coil…

Q: Given this sequence ATGCACCG About how often (every _____ bases) would this occur in double strand…

A: All DNA strands are made up of nucleotides namely Adenine (A), Thymine (T), Guanine (G), and…

Q: Show the nucleotide sequence changes that might arise in a dsDNA (coding strand segment GCTA) upon…

A: DNA provides mutagenic bases hypoxanthine and uracil when deaminated by adenine and cytosine…

Q: All transposons would have these components among A- D EXC A) O transposase B) O insertion sequences…

A: Transposable elements are those DNA sequences that move from one location on the genome to…

Q: given double stranded DNA undergoes enzymatic hydrolysis targeting only the "b" side in the…

A: Introduction The DNA helix acts as a template for its own duplication. Because the nucleotide A will…

Q: Any RNA polymerase in any organism: OA Synthesizes RNA chains in the 3' to-5 direction O B. Binds…

A: A gene is a functioning heredity unit made up of DNA that provides instructions for the creation of…

Q: Wny does the "Tagging strand" of DNA heed to be replicated "discontinuously" In Okazaki ragments? O…

A: Okazaki fragments are some isolated and short DNA nucleotide sequences which formed in a…

Q: The amount of DNA inintronic regionof genes can be grwater than the amount of DNA in exons. true

A: DNA is the genetic material in humans. It contains all the genetic information that is transferred…

Q: 6.b. Mutated DNA Template Strand #2: 3’-T A C G G A C T G A C G A T C-5’ Complementary DNA…

A: In this question, we are given with a sequence of DNA which has a mutation. Given DNA sequence is…

Q: DNA pol I O is a single subunit enzyme has a 5' to 3' exonuclease activity

A: DNA polymerase progressively adds deoxyribonucleotides to the 3'OH end of the newly synthesised…

Q: uit L Tepresents part of a DNA molecule. 5' T ATGCTT C CA TACG A AGG TCA 3' 3' G T Figure 2 (c)…

A: The process of replicating a double-stranded DNA molecule into two identical DNA molecules is known…

Q: If dhe sequence and directionality of one strand of DNA 1s 5-GCTAG-3', what is the sequence and…

A: DNA stands for deoxyribonucleic acid is composed of two polyneuclotide chains that could around each…

Q: Given this sequence (of course the DNA is double stranded, but I’m only showing one strand), will it…

A: A heritable genetic change in the genetic material of an organism that gives rise to alternate…

Q: Formation of a recombinant DNA molecule. GAATTC GAATTC CTTAAG CTAAG double-stranded DNA CAATTO…

A: Ans : In the given diagram, 1 is representing the restriction sites.

Q: During electrophoresis, DNA molecules can easily be separatedaccording to size because all DNA…

A: Introduction The technique of gel electrophoresis is used to separate DNA fragments based on their…

Q: Write the base sequence of the DNA template from whichthis RNA sequence was derived:…

A: Transcription is the process mRNA is synthesized with the help of template DNA. In this process, the…

Q: In regards to satellite DNA, the major difference between a LINE sequence and a SINE sequence is the…

A: In molecular biology, there are two types of genes ,coding and noncoding. Coding genes helps in the…

Q: DRAW IT In a DNA double helix, a region along oneDNA strand has this sequence of nitrogenous…

A: DNA is known as deoxyribonucleic acid. It is made up of two strands. DNA is made up of nucleotides.…

Q: B. Make identical strands of DNA CCTAT ATCTC TCTAT ATCTC TCATA CTGTG TGTCT CTATA (original) (new) C.…

A: The newly synthesized strand would always be complementary to the original DNA (and with opposite…

Q: When the helix axis of a closed circular duplex DNA of 2310 bp is constrained to lie in a plane, the…

A: DNA molecules have different conformational changes based upon its state that could be described by…

Q: Fréderick Griffith's discovery of transformation relies principally upon O A. slow renaturation of…

A: Answer. Frederick Griffith's discovery of transformation relies principally upon the distinction…

Question

If a person os homozygous for the presence of an ALU repeat in the PV92 region you would expect the size of the DNA fragment to be compared to those whith no ALUrepeats

Expert Solution

This question has been solved!

Explore an expertly crafted, step-by-step solution for a thorough understanding of key concepts.

SEE SOLUTION Check out a sample Q&A here

Step 1

VIEW

Step 2

VIEW

Step 3

VIEW

Step by step

Solved in 3 steps

SEE SOLUTION Check out a sample Q&A here

Knowledge Booster

Learn more about

Need a deep-dive on the concept behind this application? Look no further. Learn more about this topic, biology and related others by exploring similar questions and additional content below.

Similar questions

The amount of DNA inintronic regionof genes can be grwater than the amount of DNA in exons. true
For DNA ORF ATG.CTG.GTA.CTN.GTA.AAA, where N stand for any nucliotide (A, T, G, C) claculate the probablity of occurance of any nucliotide at position N.
Write down the double stranding sequence of the resulting DNA fragment(s) if the following DNA molecule were digested with XhoI: 5'-GGTATCCGCGGAGCTCAAATA-3' 3'-CCATAGGCGCCTCGAGTTTAT-5'
An alien organism was investigated. When DNA replicationwas studied, a unique feature was apparent: NoOkazaki fragments were observed. Create a model of DNAthat is consistent with this observation.
The sequence of a region of interest in a DNA template strand is3′–ATACGACTAGTCGGGACCATATC–5′. If the primer in a dideoxysequencing experiment anneals just to the left of this sequence, drawthe sequencing ladder that will be obtained.
Double-helical DNA has major and minor grooves becauseA. DNA-binding proteins twist the DNA into a specific shaveB. The A:T and G:C basepairs have different dimensionsC. Purines, being larger, form the major groove while pyrimidines, being smaller, form the minor grooveD. The phosphoribose backbones of the two strands are not diametrically oppositeE.
Given this sequence ATGCACCG About how often (every _____ bases) would this occur in double strand DNA that is known to contain 20%T. Show work.
Suppose you are a research assistant ina lab studying DNA-binding proteins. You have been giventhe amino acid sequences of all the proteins encoded bythe genome of a certain species and have been asked to findcandidate proteins that could bind DNA. What type of aminoacids would you expect to see in the DNA-binding regions ofsuch proteins? Explain your thinking.
DNA polymerase requires both a template, to be copied, and a primer, which provides a 3′ hydroxyl from which polymerase can extend. Yet, this molecule supports DNA polymerase activity. Explain. pTGACACAGGTTTAGCCCATCGATGGG -OH
DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ Add an A before codon 3 or delete the middle base in codon 3 to show the shift of reading frame to:a. the rightDNA:mRNA:polypeptide chain: b. the left
The original DNA sequence TACACCTTGGCGACT I need the mRNA sequence and the amino acid sequence And also the mutation type
The 50ul of your restriction digest contains 500ng of DNA how much DNA (ng) are you loading into the gel?