If hybrid DNA is allowed to replicate for one generation in medium containing N15 and for second generation in medium containing N14, then what should be the proportion of light, heavy and hybrid DNA respectively? 1. 25%, 0% and 75% 2. 0%, 25% and 75% 3. 25%, 25% and 50% 4. 0%, 0% and 100%
Q: What would be the expected distribution of centrifuged DNA (in the Meselson /Stahl experiment),…
A: Using E. coli bacteria as a model system Meselson and Stahl conducted experiments on DNA replication…
Q: compare and contrast DNA replication in the cell with PCR-based replication in the lab. Do these two…
A: DNA replication vs pCR(polymerase chain reaction). *DNA replication is a process that produce two…
Q: You are an expert molecular biologist and you just had your regular PCR run and you are now checking…
A: Following are the steps you will make to be able to avoid this in your next PCR run? 1. do the…
Q: Suppose the experiment of Meselson and Stahl was performed on a sample of 8 cells, each containing…
A: Given: The experiment of Meselson and Stahl was performed on a sample of 8 cells, each containing…
Q: In Ex 1.1 we used the Wizard DNA isolation kit to isolate the pCR2.1 vector and in Ex 1.11 we used…
A: The Wizard DNA isolation Kit is designed for the isolation of DNA from tissue culture cells, animal…
Q: Based on your understanding of homologous recombination answer the following questions. 1. What…
A: Since you have posted a question with multiple sub-parts, we will solve the first three subparts for…
Q: You have 10 ul of DNA you want to cut with HindIII, and then run a gel, in order to cut out certain…
A: Restriction Digestion is a process by which DNA molecules are cut into small pieces with the aid of…
Q: Explain in lengthy the principle of electrophoresis in nucleic acid isolation. Explain in detail the…
A: 1)Nucleic acid electrophoresis Gel electrophoresis is scientific technique used which helps us…
Q: contrast to white rice. Using recmbinant technology, golden rice is created by added two new…
A: There are six steps involved in rDNA technology. These are – isolating genetic material, restriction…
Q: DNA from a strain of Bacillus subtilis with genotype a + b + c + d + e + is used to transform a…
A: Introduction :- The basic physical and functional unit of heredity is the gene. DNA is the material…
Q: Which of the above investigators showed that rapidly-growing bacterial cells, treated with tritiated…
A: Among the given options, option (2) is the most appropriate. The aforementioned experiment was…
Q: When you go to the lab and you carry out the reaction several times, you realize that you made the…
A: The polymerase chain reaction is a technique in molecular biology that is used to amplify the target…
Q: E. coli cells grown on 15N medium are transferred to 14N mediumand allowed to grow for two more…
A: Deoxy ribonucleic acid (DNA) replication is semi-conservative in mature, which implies that each of…
Q: From the data given, which statement below most accurately describes something that has occurred in…
A: It is the movement of water molecules from a solution with a high concentration to a solution with a…
Q: If we repeated the Messelson Stahl experiment but we started with NN 4 then transgressed to NON…
A: Meselson Stahl experiment is an experiment performed by Matthew Meselson and Franklin Stahl in 1958…
Q: what would be the expected distribution of DNA by the fourth (F4) generation?
A: Ans. The mechanism of DNA replication in all known cells is represented by semi-conservative…
Q: What would be the expected distribution of centrifuged DNA (in the Meselson /Stahl experiment),…
A: Meselson and Stahl experiment The experiment carried out by Meselson and Stahl tells us about nature…
Q: f the intact chromosomes of E. coli are labeled with heavy nitrogen (15N), then E. coli is fed light…
A: Correct Answer is option 1 i.e., 12.5% intermediate-weight DNA and 87.5% light-weight DNA.
Q: What characteristics of VNTR and STR make them useful for DNA fingerprinting?
A: According to guidelines we have to answer the first question only. so please kindly post the…
Q: Using the table below, what volume from the master mix will be dispensed to each sample tube if the…
A: Answer: As we know, C1V1= C2V2, where C1 and C2 = initial and final concentrations V1 and V2 =…
Q: Why is the company Qiagen has more refined DNA extraction steps than a normal Strawberry DNA…
A: DNA extraction procedure refers to the methodology that is followed to purify the the DNA (cellular…
Q: The figure illustrates the results of RT-qPCR. Which of the following statements about the graph is…
A: Quantitative ECR is the type of PCR in which the amount of PCR product can be determined in real…
Q: A The above experiment, on DNA replication in the intact chromosomes of E. coli (with no virus…
A: 1. If the intact chromosomes of E.Coli are labeled with heavy nitrogen (15N), then is fed light…
Q: Here you see the gel electrophoresis of PCR reactions of the pMCT118 VNTR locus of 4 individuals…
A: Answer pMCT118 VNTR locus has multiple repeats that can be analyzed by Polymerase chain reaction…
Q: Four E. coli strains of genotype atb¯ are labeled 1, 2, 3, and 4. Four strains of genotype a¯b* are…
A:
Q: We run the HinDIII-digest of lambda-DNA as the standard ladder on the gel. Number the largest…
A: Restriction enzyme or restriction endonucleases are the enzymes that cleaves DNA at specific sites…
Q: Which ingredient will allow the DNA to form cloudy clumps which can be collected with tweezers salt…
A: Introduction :- A given DNA segment can be quickly multiplied (amplified) into millions or billions…
Q: The genome of a typical bacterium contains about 5 x 106 base pairs, and can be replicated in about…
A: Replication is the process of synthesis new daughter DNA strand using the existing parental DNA…
Q: Consider the experiment conducted by Meselson and Stahl in which they used 14N and 15N in cultures…
A: It was proposed that DNA replication occurs in three ways such as conservative, semiconservative and…
Q: Four E. coli strains of genotype a+ b- are labeled 1, 2, 3, and 4. Four strains of genotype a- b+…
A: A gene is the essential physical and functional unit of heredity. They are comprised of DNA…
Q: In order to replicate both strands of DNA SIMULTANEOUSLY , E. coli bacteria folds or loops one…
A: Replication is the process by which new strands are synthesized complimentary to their parent…
Q: of the following statements BEST DESCRIBES the main findings of the Meselson-Stahl experiment? A.…
A: Replication is a process of making copy of DNA molecule. Central dogma explains how the DNA makes…
Q: For the isolation of DNA from buccal cells using saline solution, concentrated soap, and ice cold…
A: For isolating DNA from buccal cells. First, we need buccal cells which we are getting…
Q: DNA from a strain of Bacillus subtilis with genotype a+ b+ c+ d+ e+ is used to transform a strain…
A: Co transformation means that the two genes are transformed simultaneously. Is two genes are co…
Q: At the end of an experiment, you extract DNA from ten yeast colonies. You divide the DNA from each…
A: Replication replicates are the tubes having same set of conditions for reducing the variability in…
Q: After two generations of replication in the Meselson and Stahl experiment, what was the composition…
A: Meselson and Stahl conducted their experiment of DNA replication on E.coli bacteria using heavy…
Q: Assuming DNA replicates semi-conservatively, which of these most closely approximates what you would…
A: DNA replicates semi-conservatively that means, each time DNA replicates, the old strand is used as…
Q: Is the formula "genotype + environment=phenotype" accurate?
A: Genotype It is the contents of genome. Phenotype It is the physical appearance.
Q: If the intact chromosomes of E. coli are labeled with heavy nitrogen (15N), then E. coli is fed…
A: This experiment was performed to check whether the DNA model is conservative or semiconservative. A…
Q: In lane 1, a size standard was loaded, which contained a mix a DNA fragments known to be 1000 bp,…
A: Introduction Comparison between the location and size of the standard and human samples dictates the…
Q: In a transformation experiment involving a recipientbacterial strain of genotype a- b-, the…
A: Introduction: According to the idea of genetic linkage, genes that are far apart or on distinct…
Q: If you have G-C rich DNA versus A-T rich DNA a.Will the melting temperatures be the same/ Why?…
A: DNA is a double stranded molecule, in which two strands wind around each other like a twisted…
Q: In sequential order, what are the three steps of PCR? A. Denature DNA, Anneal Primers, Extend…
A: Polymerase (PCR) chain reaction, is a process during which thousands of copies of the DNA can be…
Q: During a typical gel electrophoresis set up (negative pole at the top), which DNA fragment would be…
A: The answer is 100 kb .
Q: In the Meselson-Stahl experiment on DNA replication, what fraction of the DNA was composed of one…
A: In 1958, Matthew Meselson and Franklin Stahl performed an experiment which supported the DNA…
Q: Which of the following statements about gel electrophoresis is false? Choose all that apply.…
A: Gel electrophoresis is a technique used in the separation of DNA fragments .
Q: SDS-PAGE is used to help determine all of the following except: A) The purity of the recombinant…
A: A polyacrylamide gel consists of chains of acrylamide monomers cross-linked with N,…
Q: The sizes of the restriction fragments produced by cutting bacteriophage lambda DNA (48,502 bp) with…
A: DNA or deoxyribonucleic acid is a polymer of deoxyribonucleotides connected together via…
Step by step
Solved in 3 steps
- What would be the expected distribution of centrifuged DNA (in the Meselson /Stahl experiment), using only the intact chromosomes of E. coli, by the second generation (the F2 generation)? 12.5% heavy-weight DNA, and 87.5% intermediate-weight DNA 25% heavy-weight DNA, and 75% light-weight DNA 87.5% light-weight DNA, and 12.5% intermediate-weight DNA 75% heavy-weight DNA, and 25% light-weight DNA 50% intermediate-weight DNA, and 50% light-weight DNA The above experiment would demonstrate which of the following DNA replication mechanisms? completely discontinuous DNA replication completely continuous DNA replication semi-conservative DNA replication completely dispersive DNA replication completely conservative DNA replicationWhy is it important that the alcohol used in the DNA extraction is kept cold? The solubility of any compound is reduced at lower temperatures. The colder the temperature of the alcohol, the greater the yield of DNA due to increased precipitation of DNA at the interface between the aqueous and alcohol layers. The solubility of any compound is increased at lower temperatures. The colder the temperature of the alcohol, the greater the yield of DNA due to increased solubility of DNA at the interface between the aqueous and alcohol layers. The solubility of any compound is reduced at lower temperatures. The colder the temperature of the alcohol, the greater the yield of DNA due to increased precipitation of DNA in the aqueous layer. The solubility of any compound is increased at lower temperatures. The colder the temperature of the alcohol, the greater the yield of DNA due to increased solubility of DNA in the aqueous layer.Which of the following correctly describes a possible scenario during a run of gel electrophoresis with DNA samples?
- In a transformation experiment involving a recipientbacterial strain of genotype a- b-, the following resultswere obtained. What can you conclude about the locationof the a and b genes relative to each other? Transformants (%)Transforming DNA a+ b- a-b+ a+b+a+b- 3.1 1.2 0.04a+b- and a-b+ 2.4 1.4 0.03You have four tubes with buffer, primer, DNA polymerase, template, and dNTP's. In tube A, you have added radioactive ddATP at a ratio of 1 ddATP/100 dATP. In tube T, you have added radioactive ddTTP at a ratio of 1 ddTTP/100 dTTP. In tube G, you have added radioactive ddGTP at a ratio of 1 ddGTP/100 dGTP. In tube C, you have added radioactive ddCTP at a ratio of 1 ddCTP/100 dCTP. Here is a picture of the template and based paired primer. Each tube has millions of these base paired constructs. 5' - CTAGTACTGA 3' - GATCATGACTGGACTTTGGACTAGCTACAAAGTACGAGTAGAACTAGC After allowing for DNA synthesis and after denaturing the double strand DNA and after separating the single strand DNA by size in a polyacrylamide gel with the A, T, G, and C tube contents in separate lanes, and after performing autoradiography, you detect bands in the A, T, G, and C lanes. In which lane do you expect to see the smallest band? The G lane The C lane The A lane The T lane asap please.Which of the following best describes the process of DNA sequencing? a. DNA is separated on a gel, and the different bands are labeled with fluorescent nucleotides and scanned with a laser. b. A laser is used to fluorescently label the nucleotides present within the DNA, the DNA is run on a gel, and then the DNA is broken into fragments. c. Nucleotides are scanned with a laser and incorporated into the DNA that has been separated on a gel, and then the DNA is amplified with PCR. d. Fragments of DNA are produced in a reaction that labels them with any of four different fluorescent dyes, and the fragments then are run on a gel and scanned with a laser. e. DNA is broken down into its constituent nucleotides, and the nucleotides are then run on a gel and purified with a laser.
- Which of the following statements BEST DESCRIBES the main findings of the Meselson-Stahl experiment? A. DNA can be separated using centrifugation B. The semiconservative model of DNA replication is more accurate than the dispersive or conservative models of DNA replication C. Using 14N in experiments is an effective way of tracking nitrogen molecules D. Bacteria grown in the presence of a heavier nitrogen isotope (15N) will replicate at a slower rate than those that utilise a lighter nitrogen isotope (14N) E. Both strands of each new DNA double helix are brand new and synthesized from individual nucleotides1.) What characteristics of VNTR and STR make them useful for DNA fingerprinting? 2.) How does PCR minimize the problems associated with degraded DNA? 3.) What factors can cause DNA to become degraded? 4.) If Ethidium bromide was not added to a gel, what would happen? 5.) How can you tell if an individual is heterozygous for the D1S80 marker? 6.) If a negative control produces a band, what does this indicate? 7.) In an experiment, a student’s sample amplified for D1S80 produced 3 bands. It was the only DNA sample run on the gel. The student knows that there was no problem with the Thermocycler or primers because the other students in the class had the expected results of only one or two bands. What is the most likely explanation for these results?If the intact chromosomes of E. coli are labeled with heavy nitrogen (15N), then E. coli is fed light nitrogen (14N), what would be the expected distribution of DNA by the fourth (F4) generation? 12.5% intermediate-weight DNA, and 87.5% light-weight DNA 25% intermediate-weight DNA, and 75% heavy-weight DNA 50% light-weight DNA, and 50% intermediate-weight DNA 75% intermediate-weight DNA, and 25% heavy-weight DNA 87.5% intermediate-weight DNA, and 12.5% heavy-weight DNA
- If the intact chromosomes of E. coli are labeled with heavy nitrogen (15N), then E. coli is fed light nitrogen (14N), what would be the expected distribution of DNA by the fourth (F4) generation? 12.5% intermediate-weight DNA, and 87.5% light-weight DNA 25% intermediate-weight DNA, and 75% heavy-weight DNA 50% light-weight DNA, and 50% intermediate-weight DNA 75% intermediate-weight DNA, and 25% heavy-weight DNA 87.5% intermediate-weight DNA, and 12.5% heavy-weight DNA The above experiment, on DNA replication in the intact chromosomes of E. coli (with no virus infection) was first carried out by which of the following investigators? Rosalind Franklin and Maurice Wilkins Reiji Okazaki and Tuneko Okazaki Matthew Meselson and Franklin Stahl James Watson and Francis Crick Erwin Chargaff and Arthur KornbergWhat is the role of alcohol in extracting DNA? 1.DNA is a polar molecule with an overall negative charge, and as such is not soluble in alcohol, and therefore precipitates. 2.DNA is a polar molecule with an overall positive charge, and as such is not soluble in alcohol, and therefore precipitates. 3.DNA is a non polar molecule with an overall negative change, and as such is soluble in alcohol, and therefore precipitates. 4.DNA is a polar molecule with an overall positive change, and as such is soluble in alcohol, and therefore precipitates.You Purified plasmid DNA (a 6.0 kb vector) and got the following results... DNA conc: 200 ng/µL A260/280: 1.97 A260/230: 2.15 How would you to set up a ligation reaction with 50 ng of digested DNA and a 1254 base pair PCR insert present at a concentration of 23 ng/µL. How should you pipet the necessary nucleotide components (vector and PCR insert) to obtain a 1:5 vector to insert molar ratio? Keep in mind limitations of pipets when giving your answer.(e.g. Pipetes won't go below 0.5µL)