Σ00INTLLII# mduplex appears in the duplex formed in replication.nonemostOhalfOhardlyO any allQUESTION 4If we repeated the Messelson Stahl experiment but we started with N4N4 then transgressed to NTON15book, there they started with N(please note, this is not like what is in the.15and went to N14) and waited for 2 generations, we will see the following bands density-gradient centrifugation:O a single band of DNA with medium density.O one band of heavy DNA and one band of DNA with medium density.O one band of light DNA and one band of DNA with medium density.Othree bands corresponding to DNA of light, medium and heavy density.O one band of heavy DNA and one band of light DNA.QUESTION 5Click Save and Submit to save and submit. Click Save All Answers to save all answers.Save All A73°F Rain off and orF1F2F3F4F5F7F8F10F12PrtScrV25.7.4.GK.7H.BAltCtrl

Meselson Stahl experiment is an experiment performed by Matthew Meselson and Franklin Stahl in 1958…

If we repeated the Messelson Stahl experiment but we started with NN 4 then transgressed to NON (please note, this is not like what is in the. book, there they started with N and went to N4) and waited for 2 generations, we will see the following bands density-gradient centrifugation: O a single band of DNA with medium density. one band of heavy DNA and one band of DNA with medium density. one band of light DNA and one band of DNA with medium density. O three bands corresponding to DNA of light, medium and heavy density. one band of heavy DNA and one band of light DNA.

If we repeated the Messelson Stahl experiment but we started with NN 4 then transgressed to NON (please note, this is not like what is in the. book, there they started with N and went to N4) and waited for 2 generations, we will see the following bands density-gradient centrifugation: O a single band of DNA with medium density. one band of heavy DNA and one band of DNA with medium density. one band of light DNA and one band of DNA with medium density. O three bands corresponding to DNA of light, medium and heavy density. one band of heavy DNA and one band of light DNA.

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter11: Genome Alterations: Mutation And Epigenetics

Section: Chapter Questions

Problem 18QP: Replication involves a period of time during which DNA is particularly susceptible to the...

See similar textbooks

Similar questions

The following nucleotide sequence is found in a short stretch of DNA:5′–ATGT–3′3′–TACA–5If this sequence is treated with hydroxylamine, what sequences will result after replication?
5' ATTTACGTTTT 3' 3' TAAATGCAAAA 5' Need help drawing a diagram showing the replication fork at the beginning of the ORI that includes the leading strands, lagging strands, snd the Okazaki fragments of the ORI template
Which statements are true? Explain why or why not.1 The different cells in your body rarely havegenomes with the identical nucleotide sequence.2 In E. coli, where the replication fork travels at 500nucleotide pairs per second, the DNA ahead of the fork—in the absence of topoisomerase—would have to rotate atnearly 3000 revolutions per minute.3 In a replication bubble, the same parental DNAstrand serves as the template strand for leading-strandsynthesis in one replication fork and as the template forlagging-strand synthesis in the other fork.4 When bidirectional replication forks from adja-cent origins meet, a leading strand always runs into a lag-ging strand.5 DNA repair mechanisms all depend on the exis-tence of two copies of the genetic information, one in eachof the two homologous chromosomes
A scientist successfully analyzed a new micro-organism. Because this micro-organism contains double-stranded DNA as genetic material, Meselson-Stahl techniques was employed. The following shows the results of the experiment where L – light chain (14N) and H – heavy chain (15N).What is the mechanism of replication in this organism in the picture? Explain how you got the answer. The following piece of DNA is sequenced using the dideoxy method: 3’-AAGCGGCTAATCC-5’. Accidentally, you forget to include dATP in the four reactions that contain a ddNTP. What is the sequence of the daughter strand produced from this sequencing activity? Show the process. The following piece of DNA is sequenced using the dideoxy method: 3’-AAGCGGCTAATCC-5’. Accidentally, you forget to include dATP in the four reactions that contain a ddNTP. How many bands will appear in the lane containing ddATP? Show the process. The following piece of DNA is sequenced using the dideoxy method: 3’-AAGCGGCTAATCC-5’.…
The sequence of a region of interest in a DNA template strand is3′–ATACGACTAGTCGGGACCATATC–5′. If the primer in a dideoxysequencing experiment anneals just to the left of this sequence, drawthe sequencing ladder that will be obtained.
. The human genome contains about 3 billion basepairs. During the first cell division after fertilizationof a human embryo, S phase is approximately threehours long. Assuming an average DNA polymeraserate of 50 nucleotides/second over the entire S phase,what is the minimum number of origins of replicationyou would expect to find in the human genome?
Draw a molecule of DNA undergoing eukaryotic linear replication. On your drawing, identify (a) origin of replication, (b) polarity (5′ and 3′ ends) of all template and newly synthesized strands, (c) leading and lagging strands, (d) Okazaki fragments, and (e) locations of primers.
You are cloning the genome of a new DNA virus into pUC18.You plate out your transformants on ampicillin plates containing X-gal and pick one blue colony and one white colony.When you check the size of the inserts in each plasmid (blueand white), you are surprised to fi nd that the plasmid fromthe blue colony contains a very small insert of approximately60 bp, while the plasmid from the white colony does notappear to contain any insert at all. Explain these results.
Your book contains about 2 million characters (letters, spaces, and punctuation marks). If you could typewith the accuracy with which the prokaryote E. coli incorporates,proofreads, and repairs bases in replication (about one uncorrectederror in 109to 1010 bases), how many such books would you haveto type before an uncorrected error is “permitted”? (Assume thatthe error rate is one in 1010 bases.)
On further analysis of the DNA described in conceptual questionC21, you discover that the triplex DNA in this alien organism iscomposed of a double helix with a third strand wound within themajor groove (just like the DNA in Figure shown). How would youpropose that this DNA is able to replicate itself? In your answer,be specific about the base-pairing rules within the double helixand which part of the triplex DNA would be replicated first.
The chromosome of E. coli contains 4.6 million bp. How long will it take to replicate its DNA? Assuming that DNA polymerase III is the primary enzyme involved and that it can actively proofread during DNA synthesis, how many base pair mistakes will be made in one round of DNA replication in a bacterial population containing 1000 bacteria?
If the following piece of the partially double stranded DNA: 5' ATCG 3' 3' TAGCGGCATCCG 5' and add DNA polymerase, dTTP,dGTP and dCTP, what will be the sequence of the nucleotides that will be added? A. 5' ATCGCCGTAGGC 3' B 5' GGCATCCG 3' C. 5' CCGT 3' D 5'CCGTAGGC 3' E 5'GGC 3'