When you go to the lab and you carry out the reaction several times, you realize that you made the following mistakes in your different trials. What would it be the outcome in each case? Justify your answers. 1. You forgot to add one primer 2. You forgot to add dGTP 3. You added primers in the wrong concentration, and they are not in excess compared to the dsDNA. 4. You add all the required components but you heat to 95°C only once.

When you go to the lab and you carry out the reaction several times, you realize that you made the following mistakes in your different trials. What would it be the outcome in each case? Justify your answers. 1. You forgot to add one primer 2. You forgot to add dGTP 3. You added primers in the wrong concentration, and they are not in excess compared to the dsDNA. 4. You add all the required components but you heat to 95°C only once.

Biochemistry

9th Edition

ISBN:9781319114671

Author:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Publisher:Lubert Stryer, Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto Jr.

Chapter1: Biochemistry: An Evolving Science

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

The E. coli genome contains 1009 Chi sequences. Do these sequences occur at random, and, if not, how much more or less frequently than random do they occur?
Consider three different kinds of human libraries: agenomic library, a brain cDNA library, and a livercDNA library.a. Suppose that all three of these libraries are sufficiently large so as to represent all of the differenthuman nucleotide sequences that the library couldpossibly include. Which of these libraries wouldthen correspond to the largest fraction of the totalhuman genome?b. Would you expect any of these libraries not tooverlap the others at all in terms of the sequences itcontains? Explain.c. How do these three libraries differ in terms of thestarting material for constructing the clones in thelibrary?d. Why would you need to sequence many clonesfrom many cDNA libraries to annotate a genome?
You learned in Problem 21 in Chapter 7 that theneurodegenerative disease ALS can be caused by expansion of a hexanucleotide repeat region (5′-GGGGCC-3′)outside of the open reading frame (but within the firstintron) of the gene called C9ORF72. While a normalC9ORF72 allele has 2–23 copies of the hexanucleotiderepeat unit, dominant disease-causing alleles have hundreds or even thousands of copies. Researchers observed that the first intron of theC9ORF72 disease allele is transcribed not only fromthe normal template strand of DNA, but also from thenontemplate strand. Even more unusual, both types ofrepeat-region transcripts are translated in all six readingframes in an AUG-independent manner—a processcalled repeat-associated non-ATG translation, or RANtranslation. These discoveries led to the hypothesisthat the proteins made from the repeats mightcontribute to ALS.a. What polypeptides are made from the repeat-regiontranscripts?b. According to the RAN translation hypothesis, whyare…
Which of the following set(s) of primers a–d couldyou use to amplify the following target DNA sequence, which is part of the last protein-coding exonof the CFTR gene?5′ GGCTAAGATCTGAATTTTCCGAG ... TTGGGCAATAATGTAGCGCCTT 3′3′ CCGATTCTAGACTTAAAAGGCTC ... AACCCGTTATTACATCGCGGAA 5′a. 5′ GGAAAATTCAGATCTTAG 3′;5′ TGGGCAATAATGTAGCGC 3′b. 5′ GCTAAGATCTGAATTTTC 3′;3′ ACCCGTTATTACATCGCG 5′c. 3′ GATTCTAGACTTAAAGGC 5′;3′ ACCCGTTATTACATCGCG 5′d. 5′ GCTAAGATCTGAATTTTC 3′;5′ TGGGCAATAATGTAGCGC 3′
Assuming human cells have on average 1000 mitochondria, what percentage by weight of the total DNAisolated from human tissue would be mtDNA?
If you compare the frequency of the sixteen pos-sible dinucleotide sequences in the E. coli and humangenomes, there are no striking differences except for onedinucleotide, 5ʹ-CG-3ʹ. The frequency of CG dinucleotidesin the human genome is significantly lower than in E. coliand significantly lower than expected by chance. Why doyou suppose that CG dinucleotides are underrepresentedin the human genome?
See the attachment and answer the following parts of the question: A) If the binturong genome is 2.87 x 109 base pairs, and the "highly repetitive DNA" fraction is composed entirely of copies of sequence 5'ATGGTCC3' and its complement, how many copies of this sequence are present in the binturong genome? B) Briefly explain, in your own words, why the fraction of the binturong DNA fragments that reannealed relatively slowly took so much longer to renature than the other DNA fragments. C) If you took more of the same randomly generated 1000 bp fragments of binturong DNA (the same sample that you used in the equilibrium density gradient centrifugation experiment described in part a and the C0t curve described in part b of this question) and used them as a sample in agarose gel electrophoresis, how many bands would you expect to find in the gel when you turned off the current and stained the gel with ethidium bromide? Briefly explain why you would predict that number of bands.
If the bandicoot genome is 3.62 x 109 base pairs, and the "highly repetitive DNA" fraction is composed entirely of copies of sequence 5'TGCGTGTGTGC3' and its complement, how many copies of this sequence are present in the bandicoot genome?
Hi, I would like to know which program is used for the graphical presentation of the results of a meta-analysis of genome-wide linkage scans?
How many Illumina clusters would you need to generate 15X coverage of the human genome, assuming your read lenght is 600 bp? (assume a human genome size of 3 billion bp) - 2.5 billion - 75 million - 7 million - 100 million
The human genome (3.4Gb) would be 2.3 metres long if stretched linearly. In not more than 200 words, explain how a genome of this size is fit into a cell if minuscule proportions
In addition to correcting DNA mismatches, themismatch repair system functions to prevent homologousrecombination from taking place between similar but notidentical sequences. Why would recombination betweensimilar, but nonidentical sequences pose a problem forhuman cells?