In cells, certain hormones, such as epinephrine, have the ability to raise the concentration of cAMP. The CREB protein can be found in a cell extract that has been pretreated with epinephrine or not, depending on your preference. Using an electrophoretic mobility shift experiment, you test the CREB protein's capacity to attach to a DNA fragment containing a cAMP response element (CRE). Specify what you hope to achieve.

In cells, certain hormones, such as epinephrine, have the ability to raise the concentration of cAMP. The CREB protein can be found in a cell extract that has been pretreated with epinephrine or not, depending on your preference. Using an electrophoretic mobility shift experiment, you test the CREB protein's capacity to attach to a DNA fragment containing a cAMP response element (CRE). Specify what you hope to achieve.

Biology: The Dynamic Science (MindTap Course List)

4th Edition

ISBN:9781305389892

Author:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:Peter J. Russell, Paul E. Hertz, Beverly McMillan

Chapter19: Genomes And Proteomes

Section: Chapter Questions

Problem 1ITD: Below is a sequence of 540 bases from a genome. What information would you use to find the...

See similar textbooks

Similar questions

Consider the expression “central dogma,” which refers to the flow of genetic information from DNA to RNA to protein. is the word “dogma” appropriate in this context?
Suppose you are a research assistant in a lab studying dna-binding proteins. you have been given the amino acid sequences of all the proteins encoded by the genome of a certain species and have been asked to find candidate proteins that could bind dna. what type of amino acids would you expect to see in the dna-binding regions of such proteins?
You have used the technique of chromatin immunoprecipitation to isolate DNA fragments containing a DNA-binding protein of interest. Suppose that you wish to know whether a particular known DNA fragment is present in the isolated mixture. How might you detect its presence?
Can you please help me by drawing a serie of schematic figures that demonstrates the information in the paragraph below. The carboxy terminus of the p53 protein acts as an allosteric regulator of sequence-specific DNA binding. This was demonstrated initially by Hupp et al. (1992) using a bacterially expressed protein. Recombinant bacterial p53 bound poorly to DNA, and binding could be enhanced by the addition of antibodies specific to the C-terminal region of the protein. Phosphorylation of Ser315 and Ser392 within this domain also enhance sequence-specific DNA binding. Dephosphorylation of Ser376 of p53 after IR allows the association of 14-3-3 proteins with the C terminus of the protein (Waterman et al., 1998). Stavridi et al. (2001) demonstrate that this interaction is required for p53 to activate the downstream gene, p21waf1/cip1, and for the G1 cell cycle checkpoint arrest response. Interestingly, this dephosphorylation event seems to be ATM-dependent, possibly by a phosphatase…
Which of the following set(s) of primers a–d couldyou use to amplify the following target DNA sequence, which is part of the last protein-coding exonof the CFTR gene?5′ GGCTAAGATCTGAATTTTCCGAG ... TTGGGCAATAATGTAGCGCCTT 3′3′ CCGATTCTAGACTTAAAAGGCTC ... AACCCGTTATTACATCGCGGAA 5′a. 5′ GGAAAATTCAGATCTTAG 3′;5′ TGGGCAATAATGTAGCGC 3′b. 5′ GCTAAGATCTGAATTTTC 3′;3′ ACCCGTTATTACATCGCG 5′c. 3′ GATTCTAGACTTAAAGGC 5′;3′ ACCCGTTATTACATCGCG 5′d. 5′ GCTAAGATCTGAATTTTC 3′;5′ TGGGCAATAATGTAGCGC 3′
The DNA-binding domain of each CREB protein subunit recognizes the sequence 5′–TGACGTCA–3′. Due to random chance, how often would you expect this sequence to occur in the human genome, which contains approximately 3 billion base pairs? Actually, only a few doze genes are activated by the CREB protein. Does the value of a few dozen agree with the number of random occurrences expected in the human genome? If the number of random occurrences of the sequence in the human genome is much higher than a few dozen, provide at least one explanation why the CREB protein is not activating more than a few dozen gene Actually, only a few doze genes are activated by the CREB protein. Does the value of a few dozen agree with the number of random occurrences expected in the human genome? If the number of random occurrences of the sequence in the human genome is much higher than a few dozen, provide at least one explanation why the CREB protein is not activating more than a few dozen gene
The E. coli genome contains approximately 4639 kb. (a) How many copies of the 6-bp recognition sequence for the trp repressor would be expected to occur in the E. coli chromosome? (b) Explain why it is advantageous for the trp repressor to be a dimer that recognizes two adjacent 6-bp sequences.
As part of a project investigating potential new drug targets in the fight against malaria, you are seeking to clone the gene for a protein from the malaria parasite Plasmodium falciparum. You wish to express this protein in BL21 (DE3) cells, a standard laboratory strain of Escherichia coli. After purification of your protein, you run an SDS-PAGE gel and notice that the major band has lower molecular weight than expected, so you fear you are getting a truncated version. 1. What technique could you use to confirm that you are obtaining a shortened version of your intended protein? explain
As part of a project investigating potential new drug targets in the fight against malaria, you are seeking to clone the gene for a protein from the malaria parasite Plasmodium falciparum. You wish to express this protein in BL21 (DE3) cells, a standard laboratory strain of Escherichia coli. After purification of your protein, you run an SDS-PAGE gel and notice that the major band has lower molecular weight than expected, so you fear you are getting a truncated version. (a) Give TWO possible causes of your protein becoming truncated. explain
in the human gene for the beta chain of hemoglobin, the first 30 nucleotides in the amino acid coding region is represented by the sequence 3'TACCACGTGGACTGAGGACTCCTCTTCAGA-5'. What is the sequence of the partner strand? If the DNA duplex for the beta chain of hemoglobin above were transcribed from left to right, deduce the base sequence of the RNA in this coding region.
Assume that there is a double stranded break on DNA double helix of an eukaryotic cell due to X-ray radiation and it is not repaired. In addition, the cell’s Apaf-1 protein is not expressed due to a null mutation in the Apaf-1 gene. Please discuss the effect of not having Apaf-1 expression in the cell with non-repaired double stranded break.
Let’s suppose you make a transposon library of the cellulose-secreting bacterium Komagataeibacter xylinus, with the goal of finding mutants that produce higher than normal amounts of cellulose, which would be useful industrially. However, despite your best efforts you are unable to isolate any transposon mutants that make more cellulose than the wild-type strain.Why might this have failed? List as many reasons as you can think of.