In order for a fatty acid stored in an adipocyte to be oxidized by a muscle cell, which of the following will need to be present/utilized? Check all that apply. Multiple answers can be selected Acyl CoA Synthetase CD36 malate-aspartate shuttle dephosphorylated hormone-sensitive lipase GLUT 4
Q: Identify the biochemical role that each plays within a biochemical transformation:…
A: Coenzymes and cofactors are non protein components that are essential for a protein function. Most…
Q: The following are coenzymes or cofactors involved in enzymatic reactions. Identify the biochemical…
A: Enzymes are biological catalysts that increases the rate of biochemical reactions. Most enzymes are…
Q: 1. Consider the reaction: succinyl-CoA succinate H3C H3C C H₂ a. What kind of reaction is being…
A: Acetyl CoA produced from fatty acid oxidation in the hepatic cells has two possible fates: enter…
Q: A mixture of five proteins are analyzed by MALDI-TOF. Their molecular weigths are 3 kD, 22 kD, 100…
A: Mass spectrometry is an analytical method that involves ionizing materials into charged molecules so…
Q: 3. Use the structure shown below to answer the questions that follow: a b C. bottom. CH₂OH OH ) Name…
A: Carbohydrates are the important bio molecules that provide energy for the living organisms.…
Q: 1. The second high energy intermediate metabolite of glycolysis that can be used for substrate level…
A: Since you have asked multiple questions, we will solve the first question for you. If you want any…
Q: Sucrose + H2O (negative control): Colorless to brown solution: Blue solution Conclusion for Iodine…
A: Chemically carbohydrates are polyhydroxy aldehydes or ketones. They have the general formula :…
Q: Is glycogen phosphorylase a kinase? No, because it does not use ATP to transfer a phosphoryl group…
A: Glycogen phosphorylase is an enzyme activated by Phosphorylase kinase. Glycogen phosphorylase breaks…
Q: A.Provide the name for the D-monosaccharide “1” in the above image. You may ignore the alpha or…
A: There are four classes of biological macromolecule: nucleic acids, proteins, lipids and…
Q: What is meant by intrinsic GTPase activity? Exchange of GDP for GTP on the a-subunit of the G…
A: GPCRs interact with G proteins in the plasma membrane. G proteins are specialized proteins that can…
Q: A 100 mL of 0.1 M amino acid at pH 1.0, whose pKa for the carboxyl group is less than the pKa of the…
A: The amino acids carry different ionizable groups. The ionic form of the amino acids depends upon the…
Q: 1. Enzymes A) tilt the reaction equilibrium in favor of product formation B) tilt the reaction…
A: The enzymes are biological catalysts that increases the rate of biochemical reactions. Most enzymes…
Q: Dehydrogenase reactions in TCA cycle
A: Cellular respiration is a collection of three metabolic pathways that generate ATP by oxidation of…
Q: Which technique would best seperate a protein that binds stongly to its substrate?
A: Chromatography is a technique that is used for separation of biological macromolecules form a…
Q: In the figure below, Km is indicated at position labeled B Initial velocity (μM product/s) 50 45 40…
A: Km is Michaelis menton constant that corresponds to the substrate concentration at half maximal…
Q: 1. DNA: ATACGAAATCGCGATCGCGGCGATTCGG mRNA: Codon: Anticodon: Amino Acids: 2. DNA:…
A: During the process of transcription, one strand of the DNA act as the template for the synthesis of…
Q: Describe the changes that occur in each step of the mechanism.
A: Enzymes are high molecular weight proteins that catalyse biochemical reactions. Proteases are…
Q: Primer design worksheet T7 Promoter Kpn ...KS primer binding site Eco01091 Dra Il BasH II…
A: Polymerase chain reaction (PCR) is a molecular biology technique that can make multiple copies of a…
Q: Mabelle used the pET vector system to express her prokaryotic amylase enzyme. She added IPTG into…
A: In expression and purification of protein from bacterial system, the following steps are performed:…
Q: Sketch 1/v v.s. 1/[s] for enzyme 1 and enzyme 2 where enzyme 1 has same Vmax as enzyme 2 but has…
A: Enzymes are bio-catalyst that participate in biochemical process and they are highly specific in…
Q: PEP and 2-PG have similar amounts of potential metabolic energy with respect to decomposition to Pi,…
A: Glycolysis occurs in the cytoplasm of the cell. Glycolysis converts glucose into two molecules of…
Q: From which biosynthetic pathway is eugenol derived? O A. mevalonic acid OB. shikimic acid O C. mixed…
A: Eugenol is an allylbenzene derivative that is extracted from the essential oils from cloves. It is a…
Q: H H-C=0 ATP H-C-OH HO-C-H V H-COH HOOH Hexokinase H-C-OHO meras-C-OHO kinase H OH H-C-O-P-O H o- HO…
A: Glycolysis is a metabolic pathway during which glucose molecule splits into pyruvate molecules with…
Q: For paper chromatography, the obtained Rf value of an amino acid with uncharged nonpolar R group is…
A: Chromatography is performed to separate a mixture of closely related substances. Paper…
Q: 2. The Km of a particular enzyme is 2.0 x 105 M. If the initial velocity (Vo) is 0.16 mmol/min for…
A: For a one-substrate enzyme-catalyzed reaction, the Michaelis-Menton equation shows the quantitative…
Q: Riboflavin is an important nutrient required for a number of biochemical processes that produce…
A: Riboflavin is commonly known as vitamin B2. Riboflavin is a type of Vitamin B. It is soluble in…
Q: Increased ROS levels are a hallmark for Alzheimer's Disease. This is accurately described by all but…
A: Within a cell, reactive oxygen species are produced as a byproduct of oxygen metabolism and the cell…
Q: What mechanism of RNA regulation is responsible for the two different forms of apolipoprotein B? O…
A: Apolipoprotein B is encoded in humans by APOB gene. It is the primary apolipoprotein of VLDL, LDL…
Q: How can RNA sequencing (RNA-Seq) and Mirccorays in Transcriptome analysis find disease genes? Please…
A: Researchers can describe the transcriptional activity (coding and non-coding), concentrate on a…
Q: 3. In the experiment shown below, researchers looked at the effects of glucose-free medium on…
A: Glutamate is an amino acid that is synthesized from glutamine and through the transamination of…
Q: A geneticist is trying to determine how many genes are found in a 300,000 bp region of DNA. Analysis…
A: The question mentions that the geneticist is trying to figure out the number of genes that could be…
Q: Make use of the table below in answering the questions asked: Amino acid pK₁ pK₂ PK3 Isoleucine 2.32…
A: The amino acids have ionizable groups in them. The ionic form of the amino acids/ proteins depends…
Q: Chemical biologists view metabolism's citric acid cycle as its fulcrum. The enzyme isocitrate…
A: Citric acid cycle: (Krebs cycle) Citric acid, a tricarboxylic acid that is frequently referred to…
Q: 1. I Draw the amino acids Asn and His and show the most prevalent interaction that would occur…
A: Asparagine is a polar uncharged amino acid, while histidine is a polar charged amino acid.…
Q: ) How many moles of ATP can be gained from the catabolism of the following substrates to pyruvate?…
A: Since you have asked multiple questions with multiple subparts, we will solve the first question for…
Q: Bacteria and other prokaryotic cells have the capacity to get more ATP/glucose oxidized than…
A: “Since you have asked multiple question, we will solve the first question for you. If you want any…
Q: Given the following enzyme-catalyzed reaction, identify the class and subclass of the enzyme…
A: Amino acids are biomolecules that have an amino group, a carboxyl group and a side group that is…
Q: Relate the molecular properties to physicochemical properties of the following Linoleic acid…
A: Lipids are one of the 4 major biomacromolecules. Lipids are insoluble in water and soluble in…
Q: cascade? 1. Platelets expose anionic phospholipids and release thromboxanes. 2. Fibrin cross-links…
A: The process of blood clotting result in mesh formation over any wound and thus leads to blood…
Q: phosphate. Contrast the properties of hexokinases I and IV with respect to oligomeric structure,…
A: Hexokinase is an enzyme that has the ability to transfer inorganic phosphate group from ATP to the…
Q: The beta-pleated sheets are stabilized by hydrogen bonds among adjacent regions of the peptide…
A: Introduction Protein is the most abundant macromolecule in our body. proteins are made up of carbon,…
Q: A. Given the 7 proteins in the table, will they all be separated properly using isoelectric…
A: Proteins are high molecular weight biomolecules made up amino acid residues linked via a peptide…
Q: All are single-electron carriers EXCEPT: a. UQH2. b. Cyt bL. c. Cyt bH. d. Rieske protein…
A: The process electron transport chain requires four different complexes that are situated in the…
Q: HO -NH₂ NH NH HN S-CH3 ΝΗ O The peptide chain has OH residues. The name of the peptide using single…
A: Peptides are small sequences of amino acids that are joined together through peptide bonds. Peptides…
Q: How many reduced molecules (NADH, FADH2, NADPH) will be generated by converting lineoleic acid…
A: The fats are stored in eukaryotes as triglycerides that are broken down using the enzyme Lipase to…
Q: Suggest a curve illustrating the logD of amphetamine as a function of pH (from pH 1 - 14).
A: LogD is a distribution constant used to define the lipophilicity of a drug. LogD gives more accurate…
Q: Explain why quaternary structure is necessary for cooperativity and allosteric regulation. Use…
A: The proteins with two or more polypeptides are called oligomeric proteins and possess a quaternary…
Q: If glucose labeled with 14C in C-3 were metabolized by glycolysis, pyruvate would be labeled in: a.…
A: Glycolysis is the metabolic pathway by which 6 carbon glucose is converted into 3 carbon pyruvate in…
Q: ESPIRATION - What is the purpose of cellular respiration? Where is cellular respiration performed…
A: Cellular respiration is the process of oxidizing nutrients like glucose to carbon dioxide and water.…
Q: Zoey Wong is a research officer at the Department of Biosciences of Tunku Abdul Rahman University…
A: The basic principles of the central dogma of molecular biology is similar in both prokaryotic and…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- In the fasted state, FADH2 and NADH for oxidative phosphorylation are mainly provided by fatty acid oxidation. Explain how fatty acids are mobilised from adipose tissue by the action of glucagon.How does the phosphorylation of glucose within cells contribute to homeostasis?" Describe the location, enzyme kinetics and regulation of both hexokinase and glucokinase in this problem. Include the whole point of glucose phosphorylation.Glycogen synthase may be regulated by covalent modification and/or allosteric control. Label the diagram with the appropriate terms to describe glycogen synthase regulation. Use the following options: Glucose-6-Phospate; Insulin; Fructose-2,6-Bisphosphate; Phosphorylation, Dephosphorylation
- The synthesis and degradation of glycogen in muscle is not a futile (ATP-hydrolyzing)cycle because:A. glycogen synthase and phosphorylase are simultaneously activatedB. cyclic AMP activates adenylate kinase. C. when glycogen synthase is inactivated, phosphorylase is simultaneously activated. D. glycogen binds Mg2+, thereby lowering the concentration of MgATP2-Glucagon secretion inhibits intracellular acetyl-CoA carboxylase activity through a number of different methods. Make a list of everything that comes to mind.Under FASTING state, how do the hormonal changes bring about the effect to maintain glucose homeostasis in the body through the pathways of GLYCOLYSIS and GLUCONEOGENESIS; GLYCOGENOLYSIS and GLYCOGENESIS? (Please describe the signaling pathways in detail. )
- Explain why insulin is required for adipocytes to synthesize triacylglycerols from fatty acids.Glucokinase acts as a glucose sensor in hepatocytes (livercells), a- and b-cells in the pancreas, enterocytes (intestinalwall cells), and the hypothalamus (a control center in thebrain of numerous physiological processes). Explain whyglucokinase can perform this role.Ingesting large amounts of glucose before a marathon might seem to be a good way of increasing the fuel stores. However, experienced runners do not ingest glucose before a race. What is the biochemical reason for their avoidance of this potential fuel? (Hint: Consider the effect of glucose ingestion on the level of insulin.)
- Pancreatic β cells express a receptor for fatty acids. Fatty acid binding to the protein appears to stimulate insulin secretion. Does this phenomenon make metabolic sense?List reaction or pathways of fatty acid oxidation and biosynthesis affected by insulin and glucagon.A number of genetic deficiencies in acyl CoA dehydrogenases have been described. This deficiency presents early in life after a period of fasting. Symptoms include vomiting, lethargy, and sometimes coma. Not only are blood levels of glucose low ( hypoglycemia), but starvation-induced ketosis is absent. Provide a biochemical explanation for these last two observations.