You perform a translation experiment with mRNA and all required molecules in twoidentical test tubes. You add limiting amounts of the antibiotic puromycin to testtube 2 only.Puromycin is a molecule that has structural similarities to the 3' end of a chargedTRNA. It can enter the ribosome and be incorporated into the growing protein. Whenpuromycin is incorporated into the polypeptide, it stalls the ribosome and thepolypeptide is released.You do not know if puromycin recognizes a specific codon or not.You examine the length of the polypeptide produced in both test tubes.In test tube 1 (no puromycin) you get a polypeptide that is 90 amino acids long.At least how many bases was the coding region of the mRNA that you added?30 bases90 basesO 900 basesO 273 bases

Name: You perform a translation experiment with mRNA and all required molec
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: You perform a translation experiment with mRNA and all required molecules in twoidentical test tubes. You add limiting amounts of the antibiotic puromycin to testtube 2 only.Puromycin is a molecule that has structural similarities to the 3' end of a

The translation is the process of the formation of polypeptide chains of amino acids that lead to…

Answered: In test tube 1 (no puromycin) you get a…

Science

Biology

In test tube 1 (no puromycin) you get a polypeptide that is 90 amino acids long. At least how many bases was the coding region of the mRNA that you added? O 30 bases O 90 bases 900 bases 273 bases

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 10QP: The pre-mRNA transcript and protein made by several mutant genes were examined. The results are...

See similar textbooks

Similar questions

You observe a piece of mRNA. A few minutes later you see this mRNA has now been converted into DNA. How is this possible? Explain the protein responsible to do this. Also, what other sequences can this protein convert? What can this help researchers determine?
Given the following DNA sequence of the template strand for a given gene: 5' TTTCCGTCTCAGGGCTGAAAATGTTTGCTCATCGAACGC3' Part A ) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends). Part B ) Use the genetic code to write the peptide sequence translated in a cell from the mRNA in part A. Please use the 3 letter abbreviation for each amino acid. Part C: How would the peptide synthesized in a cell be different if the mRNA was translated in vitro (i.e. not in the cell)?
The nontemplate strand of a gene reads 5' ATGCGCTAGCTG 3'. What is the sequence of the mRNA transcript that would be made in this region? Group of answer choices 5' AUGCGCUAGCUG 3' 5' CAGUAGCGCAU 3' 5' UACGCGAUCGAC 3' 5' CAGCTAGCGCAT 3' 5' ATGCGCTAGCTG 3'
The main protein in egg white is ovaalbumin. The ovalbumin gene in chicken has eight exons divided by seven introns. Should the protein be produced in E. coli using ovalbumin cDNA or ovalbumin genomic DNA? Why?
Given the following tRNA anticodon sequence, derive the mRNA and the DNA template strand. Also, write out the amino acid sequence of the protein encoded by this message. tRNA: UAC UCU CGA GGC mRNA: protein: How many hydrogen bonds would be present in the DNA segment?
Eukaryotic mRNA: usessnRNPs to cut out introns and seal together translatableexons. uses a spliceosome mechanism made of DNA to recognizeconsensus sequences to cut and splice. has a guanine cap on its 39 end and a poly(A) tail on its 59 end. is composed of adenine, thymine, guanine, and cytosine. codes the guanine cap and poly(A) tail from the DNAtemplate.
Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:
Which of these choices represents one possible corresponding mRNA sequence that can be transcribed from the following DNA template? 5′ - CTGTATCCTAGCACCCAAATCGCATTAGGAC - 3′
Here is a eukaryotic gene. The numbers given are base pairs of exon and intron. How long in bases will the pre mRNA transcript be? Explain briefly. What is the maximum number of amino acids that could make up the protein product from the final mRNA? Explain briefly.
Refer to the DNA sequence provided: 3’ -TACTGAAGCGGCAGCCCCGCATGAGTAGACCTTACT-5’ a. What is the mRNA transcript of the anticoding strand of the DNA model? b. What is the amino acid sequence of the polypeptide chain that will be translated from the mRNA in (a)?
Give correct typing answer with explanation and conclusion You found a mutation in a gene that causes a reading frame shift early in its mRNA. This introduces an early stop codon that results in a complete lack of functional protein. Which of the following is the most likely cause of this mutation? A single base deletion in an exon of the gene A 6 base deletion in an intron the gene A 3 base insertion in an exon of the gene A 4 base insertion in an intron of the gene
You are working in a research lab that is surveying the CFTR gene sequence in humans to identify new alleles of the CFTR gene. Shown below is a portion of the CFTR protein-coding sequence of the gene from a person who does not have cystic fibrosis, as well as the mRNA that is produced from transcription from this gene. You can assume that the first codon starts right at 5’ end of the mRNA (we have included spacing between the codons to make it easier to translate). Coding DNA 5’- ATG GTG ACT CGT TGT GCC ATT GCA GCT AAA CAC TTC GAG CCC TGT- 3’ Template. 3’- TAC CAC TGA GCA ACA CGG TAA CGT CGA TTT GTG AAG CTC GGG ACA- 5’ mRNA 5’- AUG GUG ACU CGU UGU GCC AUU GCA GCU AAA CAC UUC GAG CCC UGU- 3’ I. What is the polypeptide sequence? You have discovered two NEW alleles. The DNA and mRNA sequences for the two new alleles that you have identified are shown below (mutation in DNA is underlined and bolded in black). II. For alleles X and Y, please: 1) write out the…