What is the answer to this problem? Macmillan LearningMacmillan LearningMacmillan LearningYou are characterizing a new DNA polymerase. When you incubate the enzyme with [³2P]-labeled DNA and no dNTPs, youobserve the release of [³²P]dNMPs. The addition of unlabeled dNTPs prevents this release.Explain the reactions that most likely underlie these observations. What would you expect to observe if you addedpyrophosphate instead of dNTPs?The new DNA polymerase possessesgenerates [³2P]dNDPs through3'→5' exonuclease5' 3' exonucleaseendonuclease✓3'5' exonuclease5' 3' helicaseactivity. The addition of pyrophosphate instead of dNTPsolymerase reaction.You are characterizing a new DNA polymerase. When you incubate the enzyme with [32P]-labeled DNA and no dNTPs, youobserve the release of [³2P]dNMPs. The addition of unlabeled dNTPs prevents this release.Explain the reactions that most likely underlie these observations. What would you expect to observe if you addedpyrophosphate instead of dNTPs?The new DNA polymerase possessesgenerates [32P]dNDPs through inhibition - of the polymerase reaction.✓[³²P]dNDPs[³2P]dNMPs[³2P]dNTPs3' 5' exonuclease activity. The addition of pyrophosphate instead of dNTPsYou are characterizing a new DNA polymerase. When you incubate the enzyme with [32P]-labeled DNA and no dNTPs, youobserve the release of [32P]dNMPs. The addition of unlabeled dNTPs prevents this release.Explain the reactions that most likely underlie these observations. What would you expect to observe if you addedpyrophosphate instead of dNTPs?The new DNA polymerase possesses 3' 5' exonuclease activity. The addition of pyrophosphate instead of dNTPsgenerates [32P]dNDPs throughinhibition of the polymerase reaction.✓ inhibitionactivationreversal

All DNA polymerases have the 5'→3' polymerase activity which enables the DNA polymerase to extend…

Answered: Macmillan Learning You are…

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter28: Dna Metabolism: Replication, Recombination, And Repair

Section: Chapter Questions

Problem 17P

See similar textbooks

Similar questions

Please help C. Even in automated sequencing, where you can include all 4 ddNTPs in one reaction, you need to include "normal" dNTPs as well as the ddNTPs - why are these necessary? Why can't you just put in the ddNTPs, since you've got all four of them available to the DNA polymerase?
5’ TAAGCGTAACCCGCTAA CGTATGCGAAC GGGTCCTATTAACGCAC 3’ 3’ ATTCGCATTGGGCGATT GCATACGCTTG CCCAGGATAATTGCGTG 5’ Imagine that the double-stranded DNA molecule shown above was broken at the sites indicated by spaces in the sequence and that before the breaks were repaired the DNA fragment between the breaks was reversed. What would be the base sequence of the repaired molecule? Show the sequence, label the 5’ and 3’ ends and briefly explain the reasoning supporting your answer
Human Genome Replication Rate Assume DNA replication proceeds at a rate of 100 base pairs per second in human cells and origins of replication occur every 300 kbp. Assume also that human DNA polymerases are highly processive and only two molecules of DNA polymerase arc needed per replication fork. How long would it take to replicate the entire diploid human genome? How many molecules of DNA polymerase does each cell need to carry out this task?
Replication involves a period of time during which DNA is particularly susceptible to the introduction of mutations. If nucleotides can be incorporated into DNA at a rate of 20 nucleotides/second and the human genome contains 3 billion nucleotides, how long will replication take? How is this time reduced so that replication can take place in a few hours?
Discuss Concepts A forensic scientist obtained a small DNA sample from a crime scene. In order to examine the sample, he increased its quantity by cycling the sample through the polymerase chain reaction. He estimated that there were 50,000 copies of the DNA in his original sample. Derive a simple formula and calculate the number of copies he will have after15 cycles of the PCR.
Semiconservative or Conservative DNA Replication If 15N-Iabeled E. coli DNA has a density of 1.724 g/mL, 14N-labeled DNA has a density of 1.710 g/mL, and E. coli cells grown for many generations on 14NH4+as a nitrogen source are transferred to media containing 15NH4+as the sole N-source, (a) What will be the density of the DNA after one generation, assuming replication is semiconservative? (b) Suppose replication took place by a conservative mechanism in which the parental strands remained together and the two progeny strands were paired. Design an experiment that could distinguish between semiconservative and conservative modes of replication.
May you please help me with this? A sample of purified DNA was incubated with deoxyribonuclease (DNAse) at 37oC. An aliquot was removed from the reaction mixture every minute for 5 minutes and the A260 recorded. The following data were obtained. Time (min) A260 0 0.60 1 0.64 2 0.67 3 0.70 4 0.72 5 0.73 Describe the action of deoxyribonuclease on DNA and explain the increase in A260.
Suppose that the double stranded DNA molecule shown was broken at the sites indicated by the gaps in the sequence, and before the gaps were repaired, the fragment in the middle was inverted. Show the sequence of the repaired DNA molecule. Keep the 5’-3’ polarity of the DNA strands and DNA polymerases in mind.) 5’- TAAGCGTAACACGCTAA CAGTAATGCAGAACT GGGTCCTATTTTCGTGCGTACAC – 3’ 3’- ATTCGCATTGTGCGATT GTCATTACGTCTTGA CCCAGGATAAAAGCACGCATGTG -5’ Please note that there are 2 gaps. The second one is between the lines (between T & G in the 1st strand and A & C in the second strand)
3’atgtaccatgcgcaaatttaaaggccc5’. a) Using this single template strand of a DNA as a template, write the base sequence of the complementary strand. b) List the molecules must be present for DNA to be replicated and briefly describe their function.
Although DNA polymerases require both a template and a primer, the following single-stranded polynucleotide was found to serve as a substrate for DNA polymerase in the absence of any additional DNA.3′ HO-ATGGGCTCATAGCCGGAGCCCTAACCGTAGACCACGAATAGCATTAGG-p 5′What is the structure of the product of this reaction?
1a) When performing classical Sanger or "dideoxy" sequencing, you set up 4 parallel reactions per template to be sequenced from a specific primer, with each of the four reactions containing a different dideoxynucleotide, and then the four reactions were run in a separate, adjacent lanes on a gel. Why couldn't you combine all 4 dideoxynucleotides with the primer and the template and do the whole reaction in one tube, and then run the set of fragments produced by the reaction mixture on a single lane in an acrylamide gel?
2) Both DNA polymerase (any DNA polymerase) and ligase catalyze the formation of a bond between nucleotides, but these two enzymes do NOT catalyze the same reaction. Briefly describe the differences between the reaction catalyzed by the polymerase activity of DNA polymerase and the one catalyzed by ligase.

SEE MORE QUESTIONS

Recommended textbooks for you

Biochemistry

ISBN:

9781305577206

Author:

Reginald H. Garrett, Charles M. Grisham

Publisher:

Cengage Learning

Biology: The Dynamic Science (MindTap Course List)

Biology

ISBN:

9781305389892

Author:

Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:

Cengage Learning

Human Heredity: Principles and Issues (MindTap Co…

Biology

ISBN:

9781305251052

Author:

Michael Cummings

Publisher:

Cengage Learning

Biochemistry

ISBN:

9781305577206

Author:

Reginald H. Garrett, Charles M. Grisham

Publisher:

Cengage Learning

Biology: The Dynamic Science (MindTap Course List)

Biology

ISBN:

9781305389892

Author:

Peter J. Russell, Paul E. Hertz, Beverly McMillan

Publisher:

Cengage Learning

Human Heredity: Principles and Issues (MindTap Co…

Biology

ISBN:

9781305251052

Author:

Michael Cummings

Publisher:

Cengage Learning

SEE MORE TEXTBOOKS