Match the following with what organelle (one per blank) it is designated to go (letter can be used once, twice or not all): A. Lysosome B. Golgi body C. Endoplasmic reticulum MRNA transcript has a KDEL (amino acid code). protein is N- glycosylated protein has a mannose-6-phosphate sugar D. Nucleus MRNA a transcript has a long string of hydrophobic amino acids E. Peroxisome MRNA transcript encodes for a string of basic amino acids

Match the following with what organelle (one per blank) it is designated to go (letter can be used once, twice or not all): A. Lysosome B. Golgi body C. Endoplasmic reticulum MRNA transcript has a KDEL (amino acid code). protein is N- glycosylated protein has a mannose-6-phosphate sugar D. Nucleus MRNA a transcript has a long string of hydrophobic amino acids E. Peroxisome MRNA transcript encodes for a string of basic amino acids

Name: Match the following with what organelle (one per blank) it is designa
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: Match the following with what organelle (one per blank) it is designated to go (letterscan be used once, twice or not all):A. LysosomeB. Golgi bodyC. Endoplasmic reticulum mRNA transcript has a KDEL (amino acid code).protein is N- glycosylatedprotei

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 17QP: Given the following mRNA, write the double-stranded DNA segment that served as the template....

See similar textbooks

Similar questions

Number the following steps of protein synthesis in the order in which they occur, starting with 1 and ending with 9.a. _____ The stop codon is reached, and the polypeptide is released.b. _____ The small ribosomal subunit finds the start codon, and the large ribosomal subunit joins.c. _____ The end of the gene is reached, and the pre-mRNA is released and then edited.d. _____ The transcription factor binds the promoter.e. _____ The protein is folded and modified to become functional.f. _____ RNA polymerase builds the mRNA transcript.g. _____ mRNA and initiator tRNA bind the small ribosomal subunit.h. _____ New tRNA molecules are brought into the A site successively, and the peptide chain of the tRNA in the P site is joined to the amino acid of the tRNA in the A site.i. _____ mRNA exits the nucleus via a nuclear pore.
Number the following steps of protein synthesis in order in which they occur, starting with 1 and ending with 9. a. ____ the stop codon is reached, and the polypeptide is released b.____ the small ribosomal subunit finds the start codon, and the large ribosomal subunit joins. c.____ the end of the gene is reached, and the pre-mRNA is released and then edited. d. ____ The transcription factor bonds the promoter. e. ____ the protein is folded and modified to become functional. f. ____ RNA polymerase builds the mRNA transcript. g. ____ mRNA and initiator tRNA bind the small ribosomal subunit. h. ____ new tRNAs are brought into the A site successively, and the peptide chain of the tRNA in the P site is joined to the amino acid of the tRNA in the A site. i. ____ mRNA exits the nucleus via a nuclear pore.
The CFTR membrane protein has an alpha helix that spans the membrane. The amino acid sequence of the central portion of this alpha helix, which is embedded within the membrane, is which one of the sequences below? Sequences are provided in the single letter code. a. VVVEVVVVEVVEEEVE b. VVVLVVVVLVVLLLVL c. VVVLVVVVREERRRER d. EEEREEEEREERRRER
Give only typing answer with explanation and conclusion which of these choices represents one possible corresponding mRNA sequence that can be transcribed by RNA polymerase, and later translated by ribosomes from the following DNA template? 5'- CTGTATCCTAGCACCCAAATCGCAT - 3'; A. 5'- CTA GCA CCC AAA TCG CAT TAG - 3', B. 5' - AUG CGA UUU GGG UGC UAG - 3', C. 5' - AUG CGA UUU GGG UGC - 3', D. 5- ATG CGA TTT GGG TCG TAG - 3'
A rare mutation can result in eukaryotic cells that causes a failure in the cell to synthesize the Signal Recognition Particle (SRP). Failure to make the SRP would impact protein synthesis by ________ . A. Preventing transition of bound ribosomes to free ribosomes B. Preventing binding of ribosomes to the rough ER during synthesis of proteins with a signal sequence C. Preventing export of mRNA out of the nuclear envelope D. Preventing binding of ribosomes to the smooth ER during synthesis of proteins with a signal sequence
All of the following regarding ribosomes are true EXCEPT: A. Ribosomes are comprised of protein and RNA. B. Ribosomes coordinate with initiation and elongation factors to regulate translation. C. Ribosomes bind transcripts in their promoters. D. Prokaryotic ribosomes are comprised of a large and a small subunit. E. Ribosomes in eukaryotic cells bind to complete transcripts.
Briefly describe the function of the following in protein synthesis. a. rRNA b. tRNA c. mRNA
Put the following processes in order of their occurrence during expression of a eukaryotic gene: a. mRNA processing c. transcription b. translation d. RNA leaves nucleus
Given the following mRNA, write the double-stranded DNA segment that served as the template. Indicate both the 5 and the 3 ends of both DNA strands. Also write out the tRNA anticodons and the amino acid sequence of the protein encoded by the mRNA message. DNA: mRNA: 5-CCGCAUGUUCAGUGGGCGUAAACACUGA-3 protein: tRNA:
Fill in the blank sentences below: ________ is a protein-lined channel in the nuclear envelope that regulates the transportation of molecules between the nucleus and the cytoplasm; inside the nucleus , ________________ process happens which involve making an RNA copy of a gene sequence known as ____ molecule, that leaves the cell nucleus through the ______ and enters the cytoplasm where it binds to a ________ that serves as a template for ______ that directs the synthesis of the protein, which it encodes; ribosomes are of two kinds, one is floating in the cytoplasm which is the ______ribosome while the other is attach to ER known as ___ ribosome; proteins in the cell can be packaged, modify and distribute by the __________ and can be delivered to an organelle that produce ATP which is the _____.
Place the steps below in the correct order to accurately reflect the steps by which a secretory protein is co-translationally imported into the lumen of the endoplasmic reticulum: As the polypeptide elongates and translocates into the ER, the signal peptidase cleaves the signal peptide. The SRP binds the SRP receptor, directing the ribosome to dock on the ER membrane. Termination of translation, results in the release of the polypeptide into the ER lumen, release of the ribosome from the ER membrane, and closing of the channel. The signal recognition particle (SRP) binds to the signal sequence on a newly synthesized polypeptide and stalls translation. The channel in the ER membrane opens and the polypeptide is inserted into the ER lumen. The SRP is released. A.6-4-2-3-1-5 B.4-2-5-1-3-6 C.3-1-6-2-4-5 D.1-2-3-4-5-6 E.2-6-1-5-4-3
You can choose one or more than one option Protein modifications occurring in the Golgi apparatus include: removal of sialic acid BiP-mediated protein folding removal of the signal peptide ubiquitination modification of high-mannose and complex N-linked oligosaccharides