scientist isolates two specific mRNAs. One codes for the enzyme fowlase, an enzyme that is involved in digestion in chickadees; the other codes for the quail enzyme quailase that is involved in cellular carbohydrate metabolism. Both mRNAs are placed in a test tube with RER vesicles stripped of their ribosomes, free ribosomes and precursors for protein synthesis. When the protein synthesis reaction is complete, fowlase is found inside the vesicles; quailase is found in the liquid portion of the test tube outside the vesicles. What can one conclude about the two proteins?

scientist isolates two specific mRNAs. One codes for the enzyme fowlase, an enzyme that is involved in digestion in chickadees; the other codes for the quail enzyme quailase that is involved in cellular carbohydrate metabolism. Both mRNAs are placed in a test tube with RER vesicles stripped of their ribosomes, free ribosomes and precursors for protein synthesis. When the protein synthesis reaction is complete, fowlase is found inside the vesicles; quailase is found in the liquid portion of the test tube outside the vesicles. What can one conclude about the two proteins?

Name: A scientist isolates two specific mRNAs. One codes for the enzyme fow
Uploaded: 2024-03-20T06:42:41.000Z
Channel: Bartleby
Description: A scientist isolates two specific mRNAs. One codes for the enzyme fowlase, an enzyme that is involved in digestion in chickadees; the other codes for the quail enzyme quailase that is involved in cellular carbohydrate metabolism. Both mRNAs are pla

Human Heredity: Principles and Issues (MindTap Course List)

11th Edition

ISBN:9781305251052

Author:Michael Cummings

Publisher:Michael Cummings

Chapter9: Gene Expression And Gene Regulation

Section: Chapter Questions

Problem 17QP: Given the following mRNA, write the double-stranded DNA segment that served as the template....

See similar textbooks

Similar questions

The base sequence of the gene coding for a short polypeptide is TAC CTA CGC TAG GCG ATT GAC T. What would be the base sequence of the mRNA transcribed from this gene? The base sequence of the gene coding for a short polypeptide is TAC CTA CGC TAG GCG ATT GAC T. From your answer to the last question, answer this Using the genetic code, give the amino acid sequence of the polypeptide translated from this mRNA. Use the three-letter abbrebviation of the amino acid and start with the start codon and stop in the stop codon.
Given the following DNA sequence of the template strand for a given gene: 5' TTTCCGTCTCAGGGCTGAAAATGTTTGCTCATCGAACGC3' Part A ) Write the mRNA that will be transcribed from the DNA sequence above (be sure to label the 5' and 3' ends). Part B ) Use the genetic code to write the peptide sequence translated in a cell from the mRNA in part A. Please use the 3 letter abbreviation for each amino acid. Part C: How would the peptide synthesized in a cell be different if the mRNA was translated in vitro (i.e. not in the cell)?
Which of the followings indicate the order of procaryotic mRNA degreadation? cleavage of the triphosphate 5′ terminus to yield a monophosphate- 3′ to 5′exonuclease digestion- The endonucleolytic cleavages occur in a 5′ to 3′ direction on the mRNA following the passage of the last ribosme cleavage of the triphosphate 5′ terminus to yield a monophosphate- The endonucleolytic cleavages occur in a 5′ to 3′ direction on the mRNA following the passage of the last ribosme- 3′ to 5′exonuclease digestion The endonucleolytic cleavages occur in a 5′ to 3′ direction on the mRNA following the passage of the last ribosme- cleavage of the triphosphate 5′ terminus to yield a monophosphate- 3′ to 5′exonuclease digestion
Imagine that you and your colleagues are working in a lab to develop a protein synthesis system for a new type of synthetic cell. During your brainstorming sessions, you propose that polycistronic mRNA would be much more useful than mRNA that is only translated into one protein. This would allow for multiple proteins necessary for a particular function to be translated together. One of your colleagues says that is a good idea, but if you decide to go with polycistronic mRNA, you’d better make sure to use a prokaryotic translation system. Why might it be problematic to use a eukaryotic translation system with polycistronic mRNA? Mention three reasons:
The length of a particular gene in human DNA, measured from the start site for transcription to the end of the protein-coding region, is 10,000 nucleotides, whereas the length of the mRNA produced from this gene is 4000 nucleotides. What is the most likely reason for this difference?
Here is a eukaryotic gene. The numbers given are base pairs of exon and intron. How long in bases will the pre mRNA transcript be? Explain briefly. What is the maximum number of amino acids that could make up the protein product from the final mRNA? Explain briefly.
A eukaryotic structural gene has two introns and three exons : 5prime end exon1 intron1 exon2 intron2 exon3 3 prime end The GU at the 5’ end of intron2 has been mutated so it is no longer recognized What would the mature mRNA look like in the wild type and in the mutant? 1-wild type? 2-mutant type?
The following is as segment of mRNA: 5'-UCGGAAUGUGGUGGCAUACAGGCUUACAGAACUAAGUCUGAGAAU-3' A. How many amino acids long will be the protein translated from the only reading frame available in this segment? B. If a mutation changes the third letter of the stop codon in the only reading frame available in this segment, how many amino acids long will be the protein translated?
Consider the following mRNA base sequence 5' CUG-CAC 3' (a) What dipeptide is coded for by this mRNA? (b) What dipeptide is formed if a mutation converts CUG to CUU? (c) What dipeptide is formed if a mutation converts CAC to CGC? (d) What dipeptide is formed if a mutation converts CUG to CUU and CAC to CGC?
What is the name of the enzyme is responsible for transcribing the DNA sequence into mRNA? In your own words, explain what this enzyme does.
Consider the mRNA base sequence 5' ACC CAC 3'. what dipeptide is coded for by this mRNA? * A. Asparagine- Histidine B. Lysine -Serine C. Aspartic Acid - Histidine D. Lysine-Glysine Look at the following sequence, " THE FAT CAT ATE THE CAT" Remove the first "H" and regroup the letters in group of three. What type of mutation? * A. Deletion-Frameshift B. Insertion- frameshift C. Substitution-Deletion D. Substitution-Insertion Which of the following types of RNA is involved in the transcription phase of protein synthesis? * A. rRNA B. tRNA C. hnRNA D. no correct response A tRNA molecule has the anticodon 5' AAG 3', with which mRNA codon will this anticodon interact? * A. 5' AAG 3 B. 5' CUU 3' C. 3' GAA 5'…
Consider the mRNA base sequence 5' ACC CAC 3'. what dipeptide is coded for by this mRNA? * A. Asparagine- Histidine B. Lysine -Serine C. Aspartic Acid - Histidine D. Lysine-Glysine Look at the following sequence, " THE FAT CAT ATE THE CAT" Remove the first "H" and regroup the letters in group of three. What type of mutation? * A. Deletion-Frameshift B. Insertion- frameshift C. Substitution-Deletion D. Substitution-Insertion Which of the following types of RNA is involved in the transcription phase of protein synthesis? * A. rRNA B. tRNA C. hnRNA D. no correct response A tRNA molecule has the anticodon 5' AAG 3', with which mRNA codon will this anticodon interact? * A. 5' AAG 3 B. 5' CUU 3' C. 3' GAA 5'…