Question

Metric 

Expert Answer

Want to see the step-by-step answer?

Check out a sample Q&A here.

Want to see this answer and more?

Experts are waiting 24/7 to provide step-by-step solutions in as fast as 30 minutes!*

*Response times may vary by subject and question complexity. Median response time is 34 minutes for paid subscribers and may be longer for promotional offers.
Tagged in
Science
Biology

Related Biology Q&A

Find answers to questions asked by students like you.

Q: If you place a cuvette with an unknown concentration of that solute in the spectrophotometer and it ...

A: The capacity of a substance to absorb light at specific wavelength is called the absorbance. The abs...

Q: Please check all statements that apply to trichomoniasis.   (NOTE:  Please change all question marks...

A: Trichomoniasis or “trich” is caused due to a parasite found in vagina and urethra or at the head par...

Q: Increase, decrease or no change (with explanation)   Influence of removing tight junctions from the ...

A: Epithelial cells are firmly adhered together by specialized connections in the plasma membranes. The...

Q: I am not sure what cells of similar type to biomolecules are organized into.

A: Cell is the smallest unit of life. It is the basic structural, functional and biological unit of all...

Q: What are the functions of Tc cells

A: Tc cells are also known as cytotoxic T cells, T-killer cells or CD8+ cells. Tc cells are a type of T...

Q: 16) What are THREE pieces of evidence that support the theory of endosymbiosis?

A: The endosymbiotic theory of evolution states that some organelles of eukaryotes, such as chloroplast...

Q: How does Mutation and Migration fit within the scope of Population Genetics?

A: Population geneticsThe study of genetic variation occurs in population is called population genetics...

Q: Biochemsitry: Deduce the structure of the disaccharide trehalose from the information given below. D...

A: a) Trehalose is a nonreducing sugar with chemical formula α-d-glucopyranosyl α-d-glucopyranoside. It...

Q: What are autocrines and paracrines in relation to the endocrine system?

A: Endocrine system in human is the system which uses hormones as chemical messenger to regulate distan...

Q: Difference between male and female pine

A: Pine trees undergo sexual reproduction by producing seeds. Pine seeds are present on scales. These s...

Q: Explain the effect of Th on B cells

A: B cells or B lymphocytes are a kind of leucocytes that are involved in humoral immunity. They are pr...

Q: What are the components of  DNA and RNA, in detail, please.

A: Deoxy ribonucleic acid (DNA) and Ribo nucleic acid (RNA) are the genetic material present in most or...

Q: What is a telomere problem and how is telomerase useful in this context?

A: Telomere is the sequence of repetitive nucleotides present at the ends of the chromosomes. Telomeres...

Q: How are bacteria and archaea alike?

A: Microorganisms are the living organisms that have a very small size and are found in all three domai...

Q: What are three basic groups of carbohydrates? Name several foods in each group.

A: Carbohydrates are biomolecules that have the general formula Cx(H2O)Y. They are synthesized by the p...

Q: What kinds of molecules often trigger our sense of smell?

A: When we sense a smell, we actually sense the presence of small vaporized molecules. So, when we smel...

Q: Blood groups- How do you determine who can donate blood to whom, and who can receive blood from whom...

A: An understanding of the ABO system has provided several medical and legal advantages. Matching ABO b...

Q: Describe the role platelets play in hemostasis.

A: Hemostasis is a complex physiological process that prevents and stops bleeding after an injury. It i...

Q: Describe the components of the left atrioventricular valve.

A: The heart has four chambers: right atrium, right ventricle, left atrium, and left ventricle. The atr...

Q: I am working on the scientific method and am confused on what a controlled variable is and what cont...

A: Hello, thank you for your questions. But according to our policy, we will be answering only the firs...

Q: explain the perneability of the descending and ascending limbs of nephron loop to water and NaCI.  h...

A: The loop of Henle of a nephron is divided into thick and thin ascending and thin descending loops. I...

Q: Can you please answer 32

A: Any alteration in the genome’s nucleotide sequence is called a mutation. It may involve small-scale ...

Q: Describe the organization of a typical eukaryote gene.

A: The structural and functional unit for hereditary in a cell is the gene. Genes are composed of DNA s...

Q: Androgen - For the hormone Androgen (in humans) what is; 1. the origin (gland that secretes the horm...

A: Hormones are the secretions of the endocrine glands. Hormones regulate the metabolic activities of t...

Q: What kind of negative feedback mechanism is place to ensure that sperm counts do t get excessively h...

A: Puberty begins in boys at the age of 12 where many physical changes occur due to sudden changes occu...

Q: This is a relevant multiple choice that I do not know how to begin with.

A: Cystic fibrosis is a genetic disease that affects the lungs and digestive system. It is caused by au...

Q: Exposing cells to which of the following drugs would inhibit the slow output response of a cell to a...

A: The binding of ligand to cell-surface receptors can induce two types of responses in the cell: Fast ...

Q: 17) There is a hypothetical gene in mice that produces a substance that induces twitchiness in leg m...

A: Twitching of muscles means muscle fiber contraction in response to a stimulus by the nervous system....

Q: Given the following DNA sequence: ATCGGATCCGGTTAACTATTTAAAGCA a. predict the compliment strand of dn...

A: Hello. Since your question has multiple sub-parts, we will solve first three sub-parts for you. If y...

Q: Can you please answer 31

A: Answer 31: Mutation is any alteration in the gene that may be caused due to deletion, addition or ch...

Q: PLEASE HELPPP

A: Click to see the answer

Q: Distinguish between each of the following pairs of terms: Neutron and proton Atomic number and mass...

A: Neutron – They are found in the nucleus of an atom.  They do not possess any charge on them they are...

Q: Explain why conditional alleles are important when we want to study lethal mutations.

A: A type of mutation in which the effects can result in the death or reduce significantly the expected...

Q: What is translation in regards to DNA?

A: DNA is a macromolecule that carries the genetic code of living organisms. DNA is one of the nucleic ...

Q: Reverse Firing of neurons allows for ? 1.  Myelin Sheath to grow2. Hard wiring of neural networks3. ...

A: Electrical signals which convey information, travel from dendrites through the cell body to the leng...

Q: 7) CRSPR-cas9 has revolutionized are ability to edit genomes. How hasthe CRSPR-cas9 system increased...

A: Genome editing is a unique technology used to make specific changes to the cell’s DNA. It is a tool ...

Q: Compare    the cellular    energy (e.g. ATP)    required and produced    when glycogen is synthesize...

A: Glycogenesis is the process of glycogen synthesis, in which glucose molecules are added to chains of...

Q: Please Help me

A: In population genetics, gene flow is the transfer of genetic variation from one population to anothe...

Q: How can we use the transposon sequence to find where the mutation occurred in a forward genetic scre...

A: Forward genetic screes, also termed as forwarding genetics, is a kind of process by which those gene...

Q: Threats on biodiversity are synergistic. This means

A: Biodiversity means the variability among living organisms in the earth from all sources such as terr...

Q: What are the 3 mechanisms that control hormone secretion (in human body)and how they are different?

A: Hormones are secreted by endocrine glands into the blood. As the glands are ductless, the hormones a...

Q: Describe how the Gram stain is performed and identify the staining characteristics of Gram(+) and Gr...

A:  Gram staining technique is majorly used to classify the two wide groups of bacteria. This technique...

Q: Why would heat production and body temperature and epinephrine and norepinephrine levels have an eff...

A: The body heat is maintained by balancing the heat loss and the heat produced by our body. The core t...

Q: What is independent assortment?

A: Traits are passed from one generation to another, based on the principles of genetic inheritance tha...

Q: Epinephrine - For the hormone Epinephrine (in humans) what is; 1. the origin (gland that secretes th...

A: Epinephrine origin – It is released by the adrenal medulla during stress.  The amino acid thyrosine ...

Q: 8) Transposons have two methods of transposition. Briefly describe each one and indicate whether gen...

A: The transposable element is the DNA sequence that can change its position within a genome. As a resu...

Q: Draw the features of a yeast knock out cassette. How does it integrate into the yeast genome generat...

A: A gene knockout is a genetic technique in which one of an organism's genes is made inoperative. Howe...

Q: 1. There are two metabolic routes for the conversion of oxaloacetate to phosphoenolpyruvate (PEP). W...

A: Hello. Since you have posted multiple questions and not specified which question needs to be solved,...

Q: How do these 2 diagrams fit within the scope of evolutionary genomics?

A: Evolutionary genomics deals with the evolution of genomes of different species. It involves the stud...