Nucleoside and nucleotide analogs are two closely related classes of anti-viral drugs that inhibit viral DNA or RNA polymerase enzymes. What is their most common mechanism of action and why are they often referred to as "chain terminators"?
Q: Influenza strains have hemaglutinins and neuraminidases on their cell surface. Briefly describe what…
A: Influenza virus is responsible for causing respiratory disease. Four types of influenza viruses are…
Q: You are interested in the activity and regulation of a protease made by the Gram-positive bacterium…
A: Gram-positive bacterium Geobacillus stearothermophilus older name was Bacillus stearothermophilus…
Q: Would you expect actinomycin D to be a competitive inhibitor of RNA polymerase? What about…
A: A drug is a chemical substance that is used to treat any pathogenic, physiological or psychological…
Q: A mutated TBP protein Explain: (a) What is the process affected? (b) What is the Effect on the…
A: TATA-Binding protein or TBP attaches specifically to particular sequence of DNA called TATA box.…
Q: What is the subunit composition of bacterial RNA polymerase holoenzyme? What are the functional…
A: Humans have both DNA (Deoxyribonucleic acid) and RNA (Ribonucleic acid) in the body. DNA is the…
Q: The ACE2 receptor protein in humans has been getting a lot of press these days, as it apparently…
A: Proteins are made of amino acids. Amino acids contain both an amino (-NH2) and a carboxyl (-COOH)…
Q: Does this protein absorb light at 280 nm? If yes, please write (as a number) how many residues…
A: Amino acids are organic compounds with functional groups namely carboxyl and amino. Proteins are…
Q: Which of the following protein domains would you expect to find in an "easily druggable" target b…
A: * protein domain is a part of protein sequence and tertiary structure that can function and evolve…
Q: In the study of the SARS-CoV virus protein codes, it was discovered that eight potential open…
A: Answer: SARS-CoV and MERS-CoV = These are the infectious respiratory diseases causing viruses.…
Q: Given the following genotypes, explain, by answering the questions in each number, how the mutation…
A: i + p + o + z - y + Complete set of gene products will not be there because z gene that codes for…
Q: xplain using 2-3 sentences the biological significance of the following peptides. Ceruloplasmin…
A: A peptide bond is generally a covalent chemical bond that conncedting two consecutive amino acid…
Q: The codon change (Gly-12 to Val-12) in human rasH that convertsit to oncogenic rasH has been…
A: The codons are the triplet sequences of the nucleotides like DNA (deoxyribonucleic acid) and RNA…
Q: Prokaryotes and eukaryotes have both evolved mechanisms to defend against viral/foreign nucleic…
A: In prokaryotes such as bacteria and archaea, the invading DNA(deoxyribonucleic acid) can be…
Q: If a viral host cell has a mutation that interferes with the addition of carbohydrates to proteins…
A: It is a multiple choice question.
Q: The bacteriophage genome consists primarily of genes encodingproteins that make up the head, collar…
A: The virus is microscopic and is even smaller than bacteria. They have their genetic material…
Q: Attenuation affects anabolic pathways, whereas repression affects either anabolic or catabolic…
A: Transcription is the process in which the DNA sequence of a gene is copied to create a molecule of…
Q: Azidothymidine is a Thymidine analog used to inhibit viral reverse transcriptase. Explain the…
A: AZT is a structural analogue of the deoxy thymidine. it was first synthesized in 1964. it failed as…
Q: RNAi is currently being tested as a therapeutic tool for genetic diseases and other conditions.…
A: RNA interference or Post-Transcriptional Gene Silencing is a simple and rapid method of silencing…
Q: As stated in the text, bacteriophages have been discovered with the following base substitutions in…
A: (a) it is possible for dUMP to be completely substituting for dTMP if the viral genome is able to…
Q: What is the signifi cance of the different DNA-binding properties of prokaryotic RNA polymerase core…
A: RNA polymerase (RNAP) is the enzyme that transcribes the genetic information in DNA to RNA.…
Q: AZT (zidovudine) inhibits the synthesis of the HIV virus RNA because AZT resembles substrate…
A: AZT is a antiretroviral medication used to prevent and threat HIV/AIDS. It is generally recommended…
Q: Which kind of therapy was given in 1990 to a four year old girl with adenosine deaminase (ADA)…
A: Answer: Introduction: ADA deficiency i.e. Adenosine deaminase deficiency is also called as severe…
Q: Various antimicrobial drugs to treat microbial infection have diverse mechanism of action. Consider…
A: Since we only answer 1 question in case of multiple question, we’ll answer the first question as the…
Q: What is the major difference between bacterial ribosomes and eukaryotic ribosomes that makes it…
A: Prokaryotes are the organisms that possess primitive cellular organization such as bacteria. They do…
Q: What eukaryotic protein has an analogous function to the sigma factor protein in bacteria?
A: The DNA-dependent RNA synthesis is catalyzed by the enzyme DNA-dependent RNA polymerase. It is made…
Q: Look at the structures and predict the type of inhibition (i.e. competitive or non-competitive)…
A: Competitive inhibitor is a structural analogue of the substrate and competes for active site of…
Q: Antibiotics that target bacterial molecules not previously exploited are desperately needed. One…
A: An antibiotic is defined as a kind of antimicrobial substance that is active against bacteria. They…
Q: Drug 1-Ivacaftor (VX-770): Ivacaftor is a potentiator that increases CFTR channel opening time. We…
A: The ivacaftor is the most effective for the mutation i.e. deletion
Q: Explain the structural activity between trans-ferulic acid and the NS2B-NS3 protease in the DENV-2…
A: Trans -ferulic acid --It is an important part of gamma - oryzanol a plant sterol complex .It…
Q: Define the following terms: a. proteasome b. ubiquitination c. ubiquitin-conjugating system d.…
A: Molecular biology is the branch of science that deals with different molecules inside the body which…
Q: Because of similarities between hypoxia associated with high altitude and COVID-19, some studies…
A: Hypoxia at high altitude : As altitude increases barometric pressure decreases . The concentration…
Q: Many patients become resistant to HIV protease inhibitors with the passage of time, owing to…
A: HIV is the human immunodeficiency virus that causes immune deficiency syndrome in humans. They are…
Q: The synthetic equivalent of neuro pharmacologically active peptides obtained from the marine snail…
A: The synthetic equivalent of neuro pharmacologically active peptides obtained from the marine snail…
Q: What make a Triple Helix useful in drug desi
A: A triple helix is a set of three congruent geometrical helices with the same axis, differing by a…
Q: Susceptibility to developing prion diseases arises from a mutation that changes aspartic acid (Asp)…
A: Fatal familial insomnia (FFI) is caused due to the replacement of aspartic acid by asparagine in the…
Q: An individual carries a somatic mutation that changes a lysinecodon into a glutamic acid codon.…
A: A mutation is an alteration or change in a deoxyribonucleic acid (DNA) sequence. Mutations can…
Q: Which of the following would be a good chemotherapy approach: blocking formation of the…
A: The cells require energy to divide, grow and multiply. The growth and division of cells are highly…
Q: Eukaryotic elongation factor 2 is inhibited by ADP ribosylation catalyzed by diphtheria toxin. What…
A: Introduction: The G protein is known for its huge part in numerous organic cycles. These proteins…
Q: In principle, RNAi may be used to fight viral infection. How might this work?
A: RNA-induced gene silencing or RNA interference (RNAi) is a defense mechanism against viruses or…
Q: A pure culture of an unknown bacterium was streaked onto plates of a variety of media. You notice…
A: Bacteria can be defined as minute living organisms which cannot be visible in naked eyes. These…
Q: Resistance to many penicillins is the result of cell wall mutations in a variety of bacteria. True…
A: Antimicrobial agents include the chemical substances that are used for the removal of…
Q: Explain the mode of action of transcription inhibitor metarrestin. Explain why transcription…
A: Transcription is the process of formation of messenger RNA from DNA. It takes place inside the…
Q: RNA was extracted from certain virus and found to contain 35% cytosine. With this information, is it…
A: Chargaff's rule: According to Chargaff's rule, purine bases [cytosine, thymine for DNA and cytosine,…
Q: Translation in eukaryotes and prokaryotes are similar and yet different. From a therapeutic…
A: Translation is the process where mRNA transcript of a particular gene is decoded to give rise to a…
Q: What is c3435T mutataion,What is the clinical implication of c3435T mutation, what is the molecular…
A: A mutation is an alteration that changes a nucleotide of nucleic acid. It mainly involves the…
Q: Which of the following would be a good chemotherapy approach: blocking formation of the…
A: Cancer is one of the most dreaded diseases of human beings and is a major cause of death all over…
Q: Tripartite motif-containing protein 5a or TRIM5a is a cellular antiviral restriction factor. Briefly…
A: Tripartite motif-containing protein 5 is also known as Ring finger protein.88 is a protein in humans…
Step by step
Solved in 2 steps
- The human RefSeq of the entire first exon of a geneinvolved in Brugada syndrome (a cardiac disordercharacterized by an abnormal electrocardiogram andan increased risk of sudden heart failure) is:5′ CAACGCTTAGGATGTGCGGAGCCT 3′The genomic DNA of four people (1–4), three ofwhom have the disorder, was subjected to singlemolecule sequencing. The following sequences represent all those obtained from each person. Nucleotidesdifferent from the RefSeq are underlined. Individual 1:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGTGCGGAGACT 3′Individual 2:5′ CAACGCTTAGGATGTGAGGAGCCT 3′Individual 3:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGGCGGAGCCT 3′Individual 4:5′ CAACGCTTAGGATGTGCGGAGCCT 3′and5′ CAACGCTTAGGATGTGTGGAGCCT 3′a. The first exon of the RefSeq copy of this gene includes the start codon. Write as much of the aminoacid sequence of the encoded protein as possible,indicating the N-to-C polarity.b. Are any of these individuals homozygotes? If so,which person and what allele?c. Is…The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCAGATCATCCCAATAGAT Assume that RNA polymerase proceeds along this template from left to right. Q.Give the sequence and identify the 5′ and 3′ ends of the RNA transcribed from this template.The anti-viral drug Acyclovir is a nucleotide analog that is lacking the 3’ OH group which is required to form a 3’→5’ phosphodiester bond. This drug is ineffective against DNA polymerases with proofreading abilities, which is why human DNA polymerases are not targeted. Acyclovir can be used to treatsevere cases of Epstein-Barr viral (EBV) infection, but has little to no effect under non-severe infections. Based on this information, EBV will use ________ DNA polymerase during severe infections and __________ DNA polymerase during non-severe infections. Human; Human EBV; Human EBV; EBV Human; EBV
- Dyskeratosis congenita (DKC) is a rare human genetic disorderaffecting telomere replication. Mutations in the genesencoding the protein or RNA subunits of telomerase resultin very short telomeres. DKC symptoms include bone marrow failure(reduced production of blood cells) and anemia. If symptoms aresevere, a bone marrow transplant may be the only form of effectivetreatment. In one case, clinicians recommended that a 27-yearoldwoman with a dominant form of DKC undergo a bone marrowtransplant to treat the disorder. Her four siblings were tested, andher 13-year-old brother was identified as the best immunologicallymatched donor. However, before being tested, he was emphaticthat he did not want to know if he had DKC. During testing, it wasdiscovered that he had unusually short telomeres and would mostlikely develop symptoms of DKC. Although the brother is an immunologically matched donor forhis sister, it would be unethical for the clinicians to transplantbone marrow from the brother to…Dyskeratosis congenita (DKC) is a rare human genetic disorderaffecting telomere replication. Mutations in the genesencoding the protein or RNA subunits of telomerase resultin very short telomeres. DKC symptoms include bone marrow failure(reduced production of blood cells) and anemia. If symptoms aresevere, a bone marrow transplant may be the only form of effectivetreatment. In one case, clinicians recommended that a 27-yearoldwoman with a dominant form of DKC undergo a bone marrowtransplant to treat the disorder. Her four siblings were tested, andher 13-year-old brother was identified as the best immunologicallymatched donor. However, before being tested, he was emphaticthat he did not want to know if he had DKC. During testing, it wasdiscovered that he had unusually short telomeres and would mostlikely develop symptoms of DKC. Why might mutations in genes encoding telomerase subunitslead to bone marrow failure?ATTTGAGCC- OriginalATTGAGCC - Mutated The example above is an example of a Nonsense Deletion- Substitution Insertion- Frameshift Deletion -Frameshift
- For the sake of simplicity, Fig. 10.4 omitted one stepof cDNA library construction. The figure impliedthat the last step of the process is the ligation ofblunt-ended cDNAs into plasmid cloning vectors.Although such ligation reactions can occur, in realitythey are highly inefficient. Instead, scientists convertblunt-ended cDNA molecules into sticky-ended molecules using adapters, and then they ligate thecDNAs into vectors with compatible sticky ends.Adapters are short, partly double-stranded DNAmolecules made by hybridization of two singlestranded oligonucleotides made in a DNA synthesizer.Suppose that the following two oligonucleotides weresynthesized and then mixed together at high concentration and at a temperature that promotes hybridization of complementary DNA sequences:5′ CCCCCG 3′5′ AATTCGGGGG 3′a. Draw the hybridized DNA molecules. These arethe adapters.b. Suppose you added the adapters and ligase enzymeto blunt-ended cDNAs at a very high molar ratio ofadapters to cDNAs, so…Nonhomologous end-joining (NHEJ) of a doublestrand break almost always results in perfect resealingof the DNA lesion, without the loss or gain of nucleotide pairs. Yet CRISPR/Cas9, which produces doublestrand breaks, is a highly efficient method of makingsmall deletions or insertions at the targeted site. Howcan you resolve this apparent contradiction?1. You have the plasmid pUC18/19, which is a circular plasmid that consists of 2686 bp. What would the number of and length of the fragments be if you cut the plasmid with the following restriction enzymes or combination of enzymes? Give a schematic representation of the digestions. a. PscI & GsuI b. ScaI, PdmI & BsaXI c. ScaI, SspI & EheI 2. You have determined that the amplicon you want to clone has enzyme restriction sites for HindIII and EcoRI. After investigation you have seen that the pUC18/19 plasmid also have these enzyme restriction sites in its multiple cloning site (MCS on map above). After enzyme digestion your amplicon is 854 bp long. a. What length will the recombinant plasmid be after you have inserted your amplicon? Show your calculation. b. In the amplicon insert you have an enzyme restriction site for NdeI at 500 bp. If you digest the recombinant plasmid with this enzyme what length will the fragments be?
- Azidothymidine is a Thymidine analog used to inhibit viral reverse transcriptase. Explain the application of this nucleoside analog as an antiviral drug and how it affects reverse transcription and therefore block the ability of the virus to hijack the host cellExplain the structural activity between trans-ferulic acid and the NS2B-NS3 protease in the DENV-2 strain? Please refer to the specific conserved domains affected in the NS2B-NS3 Protease by trans ferric acid and how trans ferric acid can prevent viral replication by inhibiting the activity of the NS2B-NS3 protease in DENV-2.Shown here is a theoretical viral mRNA sequence 5′-AUGCAUACCUAUGAGACCCUUGGA-3′ (a) Assuming that it could arise from overlapping genes, how many different polypeptide sequences can be produced? Using the chart in Figure 12–7, what are the sequences? (b) A base-substitution mutation that altered the sequence in part (a) eliminated the synthesis of all but one polypeptide. The altered sequence is shown below. Use Figure 12–7 to determine why it was altered. 5′-AUGCAUACCUAUGUGACCCUUGGA-3′
