of 17 <. O Attem Given mRNA sequences, provide the amino acid sequences, using the three-letter designations, for which they code. Refer to a table of codons. MRNA: 5'-CCGCACGGAUAU-3' amino acid sequence: Gly-Val-Pro-lle MRNA: 5'-CGCAUUGGGCAC_3 amino acid sequence: | Ala sn anoge careers privacy policy terms of use contact us help acer Cot Ctilex $2 & backs 8. i k alt ctri // く6 4

of 17 <. O Attem Given mRNA sequences, provide the amino acid sequences, using the three-letter designations, for which they code. Refer to a table of codons. MRNA: 5'-CCGCACGGAUAU-3' amino acid sequence: Gly-Val-Pro-lle MRNA: 5'-CGCAUUGGGCAC_3 amino acid sequence: | Ala sn anoge careers privacy policy terms of use contact us help acer Cot Ctilex $2 & backs 8. i k alt ctri // く6 4

Biochemistry

6th Edition

ISBN:9781305577206

Author:Reginald H. Garrett, Charles M. Grisham

Publisher:Reginald H. Garrett, Charles M. Grisham

Chapter29: Transcription And The Regulation Of Gene Expression

Section: Chapter Questions

Problem 1P

See similar textbooks

Similar questions

GGGAGTGTATACGGGATGAAGGCGATT MRNA What’s the Protein And what’s the phenotype
TACTCACCCCGTATTACGTTT What’s the MRNA Protein Phenotype
5’ATCGCGCTAGGCGCATGCTACCTAGGCTATCTGCCTAGCTATCGACTAATCTGATCGAGTCAG3’ 3’TAGCGCGATCCGCGTACGATGGATCCGATAGACGGATCGATAGCTGATTAGACTAGCTCAGTC5’ Write out the pre-mRNA for this geneWrite out the mRNA for this geneHow many amino acids does this protein have? Translate the protein Label your 5’ and 3’ UTR’s
Complete the complementary strand: mRNA transcription ATTCGAGGCTAA
17) Which mRNA modification is likely absent if the mRNA is degrading prematurely from the 5’ end of the mRNA? A) addition of the 3’ polyadenylated tail B( splicing together if exons C removal of introns D RNA editing E addition of the 7- methlgguanosine cap to the 5’ end
A single nucleotide addition and a single nucleotide deletion approximately 15 bases apart in the DNA cause aprotein change in sequence fromPhe–Ser–Pro–Arg–Leu–Asn–Ala–Val–LystoPhe–Val–His–Ala–Leu–Met–Ala–Val–Lysa. What are the old and new mRNA nucleotide sequences? (Use the codon dictionary in Figure 9-5.)b. Which nucleotide has been added? Which has beendeleted?
Explain The mRNA codon of valine is: GUC UGG CCA TTG
Which pre-mRNA processing step is important for initiating translation? poly-A tail RNA editing splicing 7-methylguanosine cap
A part of an mRNA molecule with the sequence 5-UGC GCA-3 is being translated by a ribosome. The following activated tRNA molecules are available. tRNA Anticodon Amino Acid 3-GGC-5 Proline 3-CGU-5 Alanine 3-UGC-5 Treonine 3-CCG-5 Glycine 3-ACG-5 Cysteine 3-CGC-5 Alanine Which two of them can bind correctly to the mRNA so that a dipeptide can form? a. cysteinealanine b. prolinecysteine c. glycinecysteine d. alaninealanine e. threonineglycine
A normal mRNA that reads 5’ - UGCCAUGGUAAUAACACAUGAGGCCUGAAC- 3’ has an insertion mutation that changes the sequence to 5' -UGCCAUGGUUAAUAACACAUGAGGCCUGAAC- 3’. Translate the original mRNA and the mutated mRNA, and explain how insertion mutations can have dramatic effects on proteins. (Hint: Be sure to find the initiation site.)
An adult with a history of tanning has his genome sequenced. The beginning of a protein-coding region of his DNA reads ATGGGGATATGGCAT. If the protein-coding region of a healthy adult reads ATGGGGATATGAGCAT, identify the site and type of mutation.
A single nucleotide addition and a single nucleotide deletion approximately 15 bases apart in the DNA cause a protein change in sequence fromPhe–Ser–Pro–Arg–Leu–Asn–Ala–Val–LystoPhe–Val–His–Ala–Leu–Met–Ala–Val–Lysa. What are the old and new mRNA nucleotide sequences? (Use the codon dictionary in Figure 9-5.)b. Which nucleotide has been added? Which has been deleted?