mcece.com/student/studentformative/Online ToolsJuan Bonilla Velasquez > Nimitz 20-21: CA Biology ProsynQuestion 4(6C) A section of a nucleic acid is shown below.Nontemplate strandPolymeraseRibonudeotideTemplate strandThe process represented in the diagram produces a molecule that is complementary to the template strand of DNA. What type of molecule is produced?Answernew DNAG polypeptideH messenger RNAcarbohydratesQuestion 4Next+ Previousogies inc 2021 - EdugenceSign out

DNA is the genetic material of most living organisms and it contains many genes that code for a…

Online Tools Juan Bonilla Velasquez Nimitz 20-21: CA Biology Pros Question 4 6C) A section of a nucleic acid is shown below. Nontemplate strand Polymerase Ribonucleotide Template strand EMAMA The process represented in the diagram produces a molecule that is complementary to the template strand of DNA. What type of molecule is produced? Answer new DNA G polypeptide H. messenger RNA carbohydrates

Online Tools Juan Bonilla Velasquez Nimitz 20-21: CA Biology Pros Question 4 6C) A section of a nucleic acid is shown below. Nontemplate strand Polymerase Ribonucleotide Template strand EMAMA The process represented in the diagram produces a molecule that is complementary to the template strand of DNA. What type of molecule is produced? Answer new DNA G polypeptide H. messenger RNA carbohydrates

Biology 2e

2nd Edition

ISBN:9781947172517

Author:Matthew Douglas, Jung Choi, Mary Ann Clark

Publisher:Matthew Douglas, Jung Choi, Mary Ann Clark

Chapter3: Biological Macromolecules

Section: Chapter Questions

Problem 20RQ: How does the double helix structure of DNA support its role in encoding the genome? The...

See similar textbooks

Similar questions

Let’s return to your patient with sickle cell anemia. Below is the RNA sequence from your patient and from her mother. (The ••• represents another 30 nucleotides not written out here). The affected nucleotide is indicated in BOLD. Patient’s RNA: 5’ –CUAUGACAGAGUUC•••CAUUAGCCA – 3’ Mother’s RNA: 5’ –CUAUGACAGUGUUC•••CAUUAGCCA – 3’ A) Write out the first 10 nucleotides corresponding to the DNA sequence of the coding strand for your patient in the 5' to 3' direction. B) From the information you have been given, why is it not possible to accurately write out the DNA sequence as it would really be found in the genome? (ie, what you wrote down in part A is NOT necessarily what the DNA sequence would really look like if we could examine the chromosome directly - why? And no this has nothing to do with the 30 nucleotides that aren’t written out or the mutated base). Your answer should be 1-2 sentences maximum.
Can somone check my answers are in bold please for both questions :Which is NOT true of the different conformations of DNA? A. Z-DNA is a left-handed spiral. B. Both A-DNA and B-DNA are dehydrated. C. A-DNA and B-DNA are right-handed spirals. D. A-DNA and Z-DNA segments are limited to short regions of DNA. For double-stranded DNA, consider the following base ratios: A/G C/T C/G (A+C)/(G+T) (A+G)/(C+T) (A+T)/(G+C) Which of those ratios always equals 1? A. 3, 4, and 5 B. 3 and 6 C. 1, 4, and 5 D. 4 and 6 E. 1 and 2
Please ASAP. Thank you. Regarding the double helix of DNA, which of the following is true? a. Guanine pairs up with cytosine with three hydrogen bonds b. Complementary strands of DNA are held together by covalent bonds c. The backbone consists of ribose sugars H-bonded to phosphate groups d. Uracil pairs up with adenine with two hydrogen bonds
DNA STRAND IS 3’ TAC-AGC-ACT-CAG-TCA 5’, whats the non-template/sense/coding strand from the STARND DNA? also what's the arrangement of m-RNA and the chain arrangement of the amino acids that will be made according to the order of the RNA?PLS DONT ANSWER THE DEFINITION ONLY, READ THE QUESTION CAREFULLY
Which of the following DNA double helices would be more difficultto separate into single-stranded molecules by treatment withheat, which breaks hydrogen bonds?A. GGCGTACCAGCGCATCCGCATGGTCGCGTAB. ATACGATTTACGAGATATGCTAAATGCTCTExplain your choice.
Need to understand how to do this: create the complementary strand of DNA to the DNA strand provided below: 1. ATAGGTCACCGTAA 2. TCCAGA
Problem B. DNA: Codon SegmentingThe way that DNA is often interpreted as genes is in groups of three nucleotides at a time, called “codons.” Thus, the DNA strand dna_str = 'agctttcattctgac' Can be broken into codons in the following three ways: agc ttt cat tct gac a gct ttc att ctg ac ag ctt tca ttc tga c # reading frame 0 # reading frame 1 # reading frame 2 Notice that in these lines, we start reading codons at string indexes 0, 1 and 2. The three different start indices are known as reading frames, and are called reading frame 0, reading frame 1 and reading frame 2, respectively. It is not always clear which of these frames will be read by genetic transcription mechanisms, so it is often useful to be able to be flexible and consider any of them when working with DNA strands. Write a function segment that takes as an input a string containing a DNA strand, and a reading frame (0, 1 or 2) to use. The function should return a list containing the sequence of individual codons. You…
The sequence of the DNA template strand is 3’– GACTTCC – 5’ What is the sequence of the DNA informational strand?
Hello, I would really appiarte help appreciate help. This is a blank question so I am unsure why it was rejected immeditely the first time. Thank you in advance. Identify the type of mutation and how it would affect the protein made (amino acid) if the following changes occurred in the DNA antisense strand First codon change from TAC to TAT. Third codon change from ACG to ACA. Ninth nucleotide changes from G to T. Nucleotide with adenine (A) base inserted between 3rd and 4th nucleotide. Types of Mutation Changes in the Amino Acid 1. 2. 3. 4.
DNA: 3’ TACAGTCTGTAGCGTACATTATCGTGACCGACT 5’ From the given DNA sequence above, change one base in codon 6 to show nonsense mutation.Rewrite the resulting DNA sequence below and encircle the base that you changed.DNA:mRNA:polypeptide chain:
Given the choices,a. 25b. 18c. 23d. 21how many hydrogen bonds are present in a DNA double helix fragment consisting of the following sequence in one strand: ATTGCGGTCA
DNA: The Secret of Life https://www.youtube.com/watch?v=HwPWv50YcMY There were three main groups working to discover the structure of DNA. Who were the three different teams and what techniques were they using?