Pyruvate can be converted to glucose via gluconeogenesis, or it can be oxidized to acetyl-CoA for energy production. The enzyme pyruvate carboxylase is regulated allosterically by which of the following? Oxaloacetate All of the above Acetyl CoA Glucose-6-phosphate Fructose-6-phosphate
Q: 4. General characteristics of water-soluble vitamins as components of human nutrition.
A: Vitamins are the organic compounds required in the diet in small amounts, for performing biological…
Q: 3. Briefly describe and explain the shape of the curve in Q2.
A: In an enzyme-catalysed reaction, the substrate binds reversibly to the enzyme's active site to form…
Q: 2. What is the total yield from one molecule of glucose to two molecules of L-malate? A. 2 ATP/GTP,…
A: Glucose is converted to L-malate via the following pathway: 1. Glycolysis: 1 glucose is converted to…
Q: Anaerobic pathways after glycolysis In the absence of oxygen, what anaerobic pathways can occur…
A: Introduction Glycolysis is a metabolic pathway where one glucose breaks and forms 2 molecules of…
Q: Select the correct response:
A: Tyrosine gives rise to catecholamines which includes dopamine, norepinephrine, and epinephrine.
Q: 7. To what volume must 30 mL of a 2.5M NaOH solution be diluted to make a 0.4M solution?
A: Molarity is way of representing the concentration of a solution. Molarity is number of moles of…
Q: n which of the test tubes would you say hydrolysis has taken place in this experiment? Why?
A: Enzymes are large molecular weight proteins that catalyse biochemical reactions. The substrate bind…
Q: 10. Which of the following statements regarding insulin is false? A. Insulin is a signal that…
A: To maintain normal levels of glucose in the blood, the pancreatic cells secrete two types of signal…
Q: Lipogenesis, or fatty acid synthesis, occurs in several cycles. A diagram of the reactions of the…
A: De novo synthesis of fatty acids takes place in the cytosol of all eukaryotes. Fatty acids are…
Q: What does bleach do to hair
A: Melanin, the pigment that also affects the colour of your skin, also determines the colour of your…
Q: 384 Protein Purification Methods Q4.1- What chemical properties of sodium dodecyl sulfate (SDS)…
A: SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis) is a type of electrophoresis…
Q: Draw the pentapeptide REACH (one letter abbreviations) in the most prevalent ionization state at 8.4…
A: Recall that: Amino acid sequences are written with N-terminal amino acid on the left and C-terminal…
Q: Does myoglobin have the same high affinity for CO as hemoglobin?
A: Hemoglobin is a multimeric (multi-subunit) protein that transports oxygen from lungs to tissues and…
Q: Glycolisis is process that is reversible, meaning that any product that is being formed can easily…
A: During the catabolism of amino acids, for it to be used as a respiratory substrate, first the alpha…
Q: 6) Proteins can be modified by phosphorylation, which adds a phosphate group to the hydroxyl group…
A: Protein modification - Major types of proteins modifications are phosphorylation, acetylation and…
Q: Fill in the blanks In the peptide, merrychristmas, there are a total of _____ peptide bonds and…
A: Peptide bond is the covalent bond which is formed from the condensation of two amino acids (carboxyl…
Q: The degradation of nutrients for energy is also known as oxidative metabolism. True False
A: Metabolism is the total of all chemical transformation that takes place in a living cell. One…
Q: ) What would be the predominant ionization states of this amino acid at physiological pH (7.4) and…
A: Amino acids contain an alpha-amino group, an alpha-carboxylic group, and a side chain. The side…
Q: a) A plasmid DNA in bacteria has a length of 14,000 bp and an Lk of 1300. Calculate the superhelical…
A: The linking number of DNA describes the topology of a double-stranded DNA. It is the number of times…
Q: Nomenclature of vitamins (empirical, biochemical, medical).
A: Vitamins are organic nutrients which can not be synthesized in the body, hence, need to be supplied…
Q: -Write down the complementary DNA sequence. TACCTAGCG CACATGTAGGTGGGCAAAGTT -Write down the…
A: Note: Hi! Thank you for the question. We are authorized to answer three subparts at a time. Since…
Q: Detergents disrupt hydrophobic interactions by coating hydrophobic molecules with molecules that…
A: Hemoglobin is an oligomeric protein with four polypeptides. The individual polypeptides are joined…
Q: ONE of the two amino acids that has a side chain including the modified carboxyl group, carboxamide,…
A: Amino acids are the building blocks of proteins. Amino acids are classified into polar and non polar…
Q: 1. What happens to the pyruvate made during glycolysis under anaerobic conditions? Is this a redox…
A: Glycolysis is the breakdown of one molecule of glucose (6C) into two molecules of pyruvate (2 x 3C)…
Q: In the peptide, HAPPYNEWYEAR, there are a total of removed in its formation. (Write the symbol of…
A: A peptide is a polymer of amino acid residues linked via a peptide bond. A peptide bond is a…
Q: The alkaline hydrolysis of pAUGCAGC oligonucleotide produces: O A. Uridine 2'-monophosphate, uridine…
A: Alkaline hydrolysis is a process by which RNA is degraded dur to attack of -OH ions of alkali. The…
Q: So when drugs are bound to plasma proteins, the effects are NOT intensified?
A: Drugs are chemical substances that have the capability to improve physical and mental illness.…
Q: For the amino acid arginine: Draw its complete protonic equilibria. Indicate the net charge of each…
A: Zwitterionic form is a form of molecule which has a net charge of zero.Also this form is very…
Q: 15. Cellular proteins are oftentimes post-translationally modified. Choose one of the following…
A: Post translational modification are the modifications done in the protein by covalently attaching…
Q: hat is an ONPG test? WHat is he principle behind this assay.
A: Fermentation of lactose happens by bacteria which depends on two enzymes - permease (allows lactose…
Q: 1. What is the sequence of the heptapeptide produced upon treatment with trypsin? Fill each blank…
A: Specific enzymes have specific cleavage point in amino acids. Chymotrypsin is serine…
Q: 4. A single base addition and a single base deletion approximately 15 bases apart in the mRNA…
A: As per the central dogma of molecular biology, the genetic information stored in the DNA is copied…
Q: Which of the following enzymes requires Mg2+ to carry out its function? Alcohol dehydrogenase.…
A: An enzyme draws substrates to its active site, catalyzes the chemical reaction that creates the…
Q: Proteins in/on target cells that bind messenger molecules and cause a response in the cells are…
A: Proteins are made up of amino acids which are used as a monomer unit of proteins. 22 standard…
Q: Question 15 of 25 Which of the following is true for the acid-base properties of amino acids? Select…
A: Amino acids are the building blocks of proteins . they have two functional groups amine group and…
Q: How many moles of ATP and GTP will be in use for this polypeptide chain synthesis? What…
A: As per the central dogma of molecular biology, the genetic information stored in the DNA is copied…
Q: Please write down the DNA sequence inferred from the below DNA gel. Shown are the products of a…
A: DNA is the genetic material in most living organisms. The information in a DNA molecule is encoded…
Q: Why can you not create a Ramachandran plot for RNA molecules? Is it possible to get a similar type…
A: Ramachandran plot is plot that describes the distribution of torsional angles called phi and psi ,…
Q: Does glycolysis take place in the presence of oxygen? Why or why not
A: Glycolysis is the first stage of cellular respiration in which glucose is oxidised to enter into…
Q: In gluconeogenesis, how is glucose-6-phosphate converted to glucose? is converted to glucose by…
A: Gluconeogenesis is a metabolic process that converts non-carbohydrate carbon substrates such…
Q: Which statements best describe serotonin? Select the correct response(s): It is essential for…
A: Serotonin is a neurotransmitter that is important for inducing sleep, for modulation of memory,…
Q: ________________ is the general term for molecules that enzymes modify to produce reaction products.
A: The enzymes are biological catalysts that are mostly protein in nature. The enzymes increases the…
Q: It is obtained from the milky secretion of various plants such as the tree Hevea brasiliensis.…
A: Hevea brasiliensis, the Para rubber tree, or most commonly, rubber tree or rubber plant, is a flower…
Q: A peptide has the following amino acid composition: 2 Met, 2 Phe, 2 Glu, 1 Arg, 1 Lys, 1 Val, 1 Leu,…
A: Recall that: Amino acid sequences are written with N-terminal amino acid on the left and C-terminal…
Q: Calculate the approximate concentration of the uncharged form of alanine (see below) in a 0.01M…
A: Recall that: Dissociation of a weak acid is mathematically described by the Henderson-Hasselbalch…
Q: Which of the following is associated with the process of ATP re-synthesis during exercise? a.…
A: During exercise, the muscles are reliant upon the ATP molecules. ATPs provide the energy essential…
Q: The gels we will be using for electrophoresis during the next lab consist of 1% agarose. Suppose you…
A: There are different ways to denote the concentration of a solution. Per cent (w/v) means there is 1…
Q: Only 0.1% of peptide bonds have the cis configuration. Calculate the difference in energy between a…
A: A peptide bond is formed between the alpha carboxyl group of the amino acid residue at the N…
Q: What is the product of the beta oxidation of this fatty acid?
A: The given fatty acid is caproic acid. Beta-oxidation is the oxidation of fatty acid on the…
Q: Describe how a protein’s structure determines its function. What determines a protein’s structure?
A: Proteins have four levels of conformations known as primary, secondary, tertiary, and quaternary. In…
Trending now
This is a popular solution!
Step by step
Solved in 2 steps
- The same reactions that were seen in the process of converting pyruvate to acetyl-S-CoA, occur in step ____ of the citric acid cycle as ____________ is converted to _________________.Elevated levels of acetyl-CoA will act as an effector for which of the following enzymes? more than one can be correct Pyruvate carboxylase. Pyruvate kinase Pyruvate dehydrogenase. Citrate synthase a-Ketoglutarate dehydrogenase.One of the consequences of ethanol addiction is fattyliver disease, an illness in which liver cells accumulatetriacylglycerols, the esters derived from glycerol and fattyacids. Ethanol is oxidized in the cytoplasm of liver cells byalcohol dehydrogenase and aldehyde dehydrogenase to yieldacetate and 2 NADH. Acetate is then transported into themitochondrion, where it is converted to acetyl-CoA andmetabolized by the citric acid cycle. When alcohol is consumed in excessive quantities, the resulting high levels ofNADH cause metabolic abnormalities, one of which is highlevels of fatty acid synthesis. Fatty acid synthesis, also acytoplasmic process, uses acetyl-CoA as a substrate andNADPH as a reducing agent. Determine how a high level ofcytoplasmic NADH provides a source of NADPH for fattyacid synthesis.
- Identify the Krebs cycle enzyme that consumes a 3-carbon substrate molecule, producing a 2- carbon product molecule (attached to acetyl-CoA), along with NADH, and one molecule of CO2. succinyl CoA synthetase a-ketoglutarate dehydrogenase pyruvate dehydrogenase isocitrate dehydrogenase malate dehydrogenaseWhich of the following is NOT a component of the pyruvate dehydrogenase complex? a. dihydrolipoyl dehydrogenase b. dihydrolipoyl transacetylase c. pyruvate dehydrogenase d. dihydrolipoyl catalaseFor the pyruvate dehydrogenase complex, please identify the oxidation states of every atom and prove whether the reaction is oxidized or not Pyruvate --> Hydroxyethyl TPP B. Hydroexythl TPP --> Acetyl Lipoylysine C. Acetyl Lipoylysine --> Acetyl-CoA
- How similar of an effect would a mutation in pyruvate dehydrogenase have, compared to a mutation in pyruvate carboxylase that blocks its ability to be regulated by acetyl-CoA?fatty acid breakdown generates a large amount of acetyl CoA. What will be the effect of fatty acid breakdown on pyruvate dehydrogenase complex activity? On glycolysis?To begin the TCA cycle, pyruvate must be converted into acetyl-Coenzyme A (acetyl-CoA) by the enzyme complex of pyruvate dehydrogenase. This complex requires 5 different coenzymes to function properly. What are they?
- Which of the following is NOT a metabolic fate of pyruvate? The pyruvate dehydrogenase complex catalyzes the oxidative decarboxylation of pyruvate to form acetyl-CoA. Pyruvate carboxylase catalyzes the carboxylation of pyruvate to form oxaloacetate. Pyruvate kinase catalyzes the formation of phosphoenolpyruvate from pyruvate. Lactate dehydrogenase catalyzes the formation of lactate from pyruvate.Which of the following citric acid cycle enzymes catalyzes substrate-level phosphorylation? A) isocitrate dehydrogenase B) α-ketoglutarate dehydrogenase C) succinyl CoA synthetase D) succinate dehydrogenase E) malate dehydrogenaseThe acyl-CoA dehydrogenase deficiency diseases are a groupof inherited defects that impair the b-oxidation of fatty acids.Symptoms of the disease range from nausea and vomiting tofrequent comas. Symptoms may be alleviated by eating regularly and avoiding periods of starvation (12 hours or more).Why does this simple procedure alleviate the symptoms?